Incidental Mutation 'R3858:Zfp512'
ID 276249
Institutional Source Beutler Lab
Gene Symbol Zfp512
Ensembl Gene ENSMUSG00000062761
Gene Name zinc finger protein 512
Synonyms
MMRRC Submission 040786-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock # R3858 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 31452431-31481754 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 31472840 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 222 (R222L)
Ref Sequence ENSEMBL: ENSMUSP00000143874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076264] [ENSMUST00000200782] [ENSMUST00000201450] [ENSMUST00000202244]
AlphaFold Q69Z99
Predicted Effect possibly damaging
Transcript: ENSMUST00000076264
AA Change: R339L

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000075613
Gene: ENSMUSG00000062761
AA Change: R339L

DomainStartEndE-ValueType
low complexity region 51 65 N/A INTRINSIC
low complexity region 92 106 N/A INTRINSIC
Blast:ZnF_C2H2 172 197 2e-8 BLAST
ZnF_C2H2 200 223 3.78e-1 SMART
ZnF_C2H2 254 276 2.63e2 SMART
ZnF_C2H2 290 313 3.39e-3 SMART
ZnF_C2H2 408 430 7.37e1 SMART
ZnF_C2H2 442 465 3.11e-2 SMART
low complexity region 485 511 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200782
AA Change: R222L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143874
Gene: ENSMUSG00000062761
AA Change: R222L

DomainStartEndE-ValueType
Blast:ZnF_C2H2 55 79 9e-9 BLAST
ZnF_C2H2 83 106 1.6e-3 SMART
ZnF_C2H2 137 159 1.1e0 SMART
ZnF_C2H2 173 196 1.5e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000201450
AA Change: R185L

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144433
Gene: ENSMUSG00000062761
AA Change: R185L

DomainStartEndE-ValueType
ZnF_C2H2 46 69 1.6e-3 SMART
ZnF_C2H2 100 122 1.1e0 SMART
ZnF_C2H2 136 159 1.5e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000202244
AA Change: R283L

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143860
Gene: ENSMUSG00000062761
AA Change: R283L

DomainStartEndE-ValueType
low complexity region 51 65 N/A INTRINSIC
low complexity region 92 106 N/A INTRINSIC
Blast:ZnF_C2H2 172 197 1e-8 BLAST
ZnF_C2H2 200 223 1.6e-3 SMART
ZnF_C2H2 352 374 3.2e-1 SMART
ZnF_C2H2 386 409 1.4e-4 SMART
low complexity region 429 455 N/A INTRINSIC
Meta Mutation Damage Score 0.2947 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing four putative zinc finger motifs. Zinc finger motifs may bind to proteins or nucleic acids. Zinc finger-containing proteins are involved in a variety of processes, including regulation of transcription. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,813,581 S179T probably benign Het
Ahnak A G 19: 9,010,859 E3169G possibly damaging Het
Ccdc82 G A 9: 13,252,079 probably benign Het
Ccng1 A G 11: 40,753,833 L79P probably damaging Het
Cd2ap G A 17: 42,816,572 Q377* probably null Het
Celf1 A G 2: 91,012,741 E411G probably damaging Het
Cps1 A G 1: 67,168,278 Y582C probably damaging Het
Efhb A G 17: 53,462,780 L167S possibly damaging Het
Erc2 A G 14: 28,475,642 probably benign Het
Hs3st1 G A 5: 39,614,913 T129I probably damaging Het
Irs4 T C X: 141,724,063 E379G probably damaging Het
Kcnmb2 T C 3: 32,198,301 V217A probably damaging Het
Megf10 T C 18: 57,275,835 probably benign Het
Mib1 T A 18: 10,798,409 C757S possibly damaging Het
Mtmr4 G A 11: 87,597,262 V24M probably damaging Het
Obscn A G 11: 59,080,969 probably benign Het
Olfr103 A T 17: 37,337,226 L2* probably null Het
Olfr1475 T A 19: 13,480,130 I23F possibly damaging Het
Pirb T C 7: 3,717,663 K279E possibly damaging Het
Pmp22 T C 11: 63,134,475 S45P probably benign Het
Pth2r A T 1: 65,322,047 I52F probably damaging Het
Reck A G 4: 43,930,261 T612A probably benign Het
Rtn4rl2 A G 2: 84,880,386 probably null Het
Sis A G 3: 72,928,652 I868T probably damaging Het
Slc23a3 A G 1: 75,129,396 probably null Het
Slc4a1 A T 11: 102,357,121 V349E probably benign Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Tle4 G A 19: 14,468,213 T223I probably benign Het
Tmem2 A G 19: 21,852,234 T1236A probably benign Het
Tmem29 T C X: 150,420,361 Q39R probably benign Het
Tor3a T A 1: 156,669,554 L140F probably damaging Het
Vmn2r86 A G 10: 130,455,725 M57T probably benign Het
Other mutations in Zfp512
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Zfp512 APN 5 31473496 missense probably damaging 1.00
IGL02657:Zfp512 APN 5 31471157 missense probably damaging 1.00
PIT4504001:Zfp512 UTSW 5 31476881 critical splice donor site probably null
R2054:Zfp512 UTSW 5 31465449 missense probably benign 0.03
R2228:Zfp512 UTSW 5 31465575 missense probably damaging 1.00
R2679:Zfp512 UTSW 5 31465454 missense probably benign 0.00
R2982:Zfp512 UTSW 5 31476778 splice site probably null
R3855:Zfp512 UTSW 5 31480249 missense possibly damaging 0.88
R3857:Zfp512 UTSW 5 31472840 missense probably damaging 1.00
R4603:Zfp512 UTSW 5 31480226 missense probably benign 0.07
R4827:Zfp512 UTSW 5 31472814 missense probably benign 0.16
R4915:Zfp512 UTSW 5 31476865 missense probably damaging 1.00
R4918:Zfp512 UTSW 5 31476865 missense probably damaging 1.00
R5906:Zfp512 UTSW 5 31480064 missense probably damaging 1.00
R6520:Zfp512 UTSW 5 31466640 missense probably damaging 1.00
R7508:Zfp512 UTSW 5 31473539 missense possibly damaging 0.95
R8485:Zfp512 UTSW 5 31480057 missense probably damaging 0.98
R8513:Zfp512 UTSW 5 31480081 missense probably damaging 0.98
R8768:Zfp512 UTSW 5 31473538 missense probably damaging 0.98
R8795:Zfp512 UTSW 5 31476790 missense probably damaging 1.00
R9055:Zfp512 UTSW 5 31480189 nonsense probably null
R9214:Zfp512 UTSW 5 31480090 missense probably damaging 1.00
R9440:Zfp512 UTSW 5 31471015 missense possibly damaging 0.92
R9551:Zfp512 UTSW 5 31466332 missense probably benign
R9552:Zfp512 UTSW 5 31466332 missense probably benign
R9635:Zfp512 UTSW 5 31466325 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CGGCTTACCCTCATATGTGG -3'
(R):5'- TCCATACTGGGAAGCATTCTAC -3'

Sequencing Primer
(F):5'- GTAGCATACATACCTGTGAGCATGC -3'
(R):5'- CTGGGAAGCATTCTACACAATG -3'
Posted On 2015-04-06