Incidental Mutation 'R3858:Efhb'
ID276264
Institutional Source Beutler Lab
Gene Symbol Efhb
Ensembl Gene ENSMUSG00000023931
Gene NameEF hand domain family, member B
Synonyms4921525D22Rik
MMRRC Submission 040786-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R3858 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location53398889-53463321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53462780 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 167 (L167S)
Ref Sequence ENSEMBL: ENSMUSP00000024725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024725]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024725
AA Change: L167S

PolyPhen 2 Score 0.612 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000024725
Gene: ENSMUSG00000023931
AA Change: L167S

DomainStartEndE-ValueType
low complexity region 565 574 N/A INTRINSIC
EFh 585 613 2.14e-1 SMART
EFh 621 649 1.98e0 SMART
Meta Mutation Damage Score 0.1038 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,813,581 S179T probably benign Het
Ahnak A G 19: 9,010,859 E3169G possibly damaging Het
Ccdc82 G A 9: 13,252,079 probably benign Het
Ccng1 A G 11: 40,753,833 L79P probably damaging Het
Cd2ap G A 17: 42,816,572 Q377* probably null Het
Celf1 A G 2: 91,012,741 E411G probably damaging Het
Cps1 A G 1: 67,168,278 Y582C probably damaging Het
Erc2 A G 14: 28,475,642 probably benign Het
Hs3st1 G A 5: 39,614,913 T129I probably damaging Het
Irs4 T C X: 141,724,063 E379G probably damaging Het
Kcnmb2 T C 3: 32,198,301 V217A probably damaging Het
Megf10 T C 18: 57,275,835 probably benign Het
Mib1 T A 18: 10,798,409 C757S possibly damaging Het
Mtmr4 G A 11: 87,597,262 V24M probably damaging Het
Obscn A G 11: 59,080,969 probably benign Het
Olfr103 A T 17: 37,337,226 L2* probably null Het
Olfr1475 T A 19: 13,480,130 I23F possibly damaging Het
Pirb T C 7: 3,717,663 K279E possibly damaging Het
Pmp22 T C 11: 63,134,475 S45P probably benign Het
Pth2r A T 1: 65,322,047 I52F probably damaging Het
Reck A G 4: 43,930,261 T612A probably benign Het
Rtn4rl2 A G 2: 84,880,386 probably null Het
Sis A G 3: 72,928,652 I868T probably damaging Het
Slc23a3 A G 1: 75,129,396 probably null Het
Slc4a1 A T 11: 102,357,121 V349E probably benign Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Tle4 G A 19: 14,468,213 T223I probably benign Het
Tmem2 A G 19: 21,852,234 T1236A probably benign Het
Tmem29 T C X: 150,420,361 Q39R probably benign Het
Tor3a T A 1: 156,669,554 L140F probably damaging Het
Vmn2r86 A G 10: 130,455,725 M57T probably benign Het
Zfp512 G T 5: 31,472,840 R222L probably damaging Het
Other mutations in Efhb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Efhb APN 17 53462453 missense probably damaging 1.00
IGL00990:Efhb APN 17 53462621 missense possibly damaging 0.86
IGL02041:Efhb APN 17 53426259 missense probably damaging 1.00
IGL02247:Efhb APN 17 53401624 missense probably benign 0.00
IGL02637:Efhb APN 17 53449552 missense probably benign 0.26
IGL02704:Efhb APN 17 53426269 missense probably damaging 1.00
IGL03083:Efhb APN 17 53399059 missense probably damaging 1.00
IGL03090:Efhb APN 17 53462930 missense probably benign 0.01
IGL03221:Efhb APN 17 53398986 missense probably damaging 1.00
PIT4531001:Efhb UTSW 17 53445775 missense probably damaging 1.00
R0632:Efhb UTSW 17 53413459 splice site probably benign
R1234:Efhb UTSW 17 53451587 nonsense probably null
R1466:Efhb UTSW 17 53437178 missense probably damaging 0.99
R1466:Efhb UTSW 17 53437178 missense probably damaging 0.99
R1471:Efhb UTSW 17 53399112 missense possibly damaging 0.46
R1624:Efhb UTSW 17 53426278 missense probably damaging 1.00
R2019:Efhb UTSW 17 53401477 missense probably damaging 1.00
R2085:Efhb UTSW 17 53426909 critical splice donor site probably null
R2226:Efhb UTSW 17 53462429 critical splice donor site probably null
R2415:Efhb UTSW 17 53463096 missense probably benign 0.01
R3848:Efhb UTSW 17 53426996 splice site probably benign
R4581:Efhb UTSW 17 53426275 missense probably damaging 1.00
R4712:Efhb UTSW 17 53451669 missense probably damaging 1.00
R4731:Efhb UTSW 17 53426244 missense probably damaging 1.00
R4732:Efhb UTSW 17 53426244 missense probably damaging 1.00
R4733:Efhb UTSW 17 53426244 missense probably damaging 1.00
R5375:Efhb UTSW 17 53401626 missense possibly damaging 0.93
R5886:Efhb UTSW 17 53451554 missense probably benign 0.42
R6054:Efhb UTSW 17 53398999 missense possibly damaging 0.90
R6195:Efhb UTSW 17 53462552 missense possibly damaging 0.62
R6233:Efhb UTSW 17 53462552 missense possibly damaging 0.62
R6450:Efhb UTSW 17 53452604 missense possibly damaging 0.77
R6550:Efhb UTSW 17 53421940 missense probably benign 0.06
R6701:Efhb UTSW 17 53399063 missense probably benign 0.41
R6967:Efhb UTSW 17 53463168 missense probably benign 0.03
R7157:Efhb UTSW 17 53400900 missense probably damaging 1.00
R7441:Efhb UTSW 17 53401521 missense possibly damaging 0.78
R7694:Efhb UTSW 17 53400808 missense probably damaging 0.99
R8044:Efhb UTSW 17 53399115 missense probably benign 0.41
R8176:Efhb UTSW 17 53400846 missense probably damaging 1.00
R8309:Efhb UTSW 17 53449535 missense probably damaging 0.99
R8311:Efhb UTSW 17 53413461 critical splice donor site probably null
R8821:Efhb UTSW 17 53400744 critical splice donor site probably benign
R8882:Efhb UTSW 17 53462684 missense probably damaging 1.00
RF003:Efhb UTSW 17 53400891 missense probably damaging 1.00
RF012:Efhb UTSW 17 53413517 missense probably damaging 0.97
Z1177:Efhb UTSW 17 53437126 missense possibly damaging 0.94
Z1177:Efhb UTSW 17 53437183 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CAAATGGACATTCAGAAGGTTCTC -3'
(R):5'- GGACTTCACAAAGGCTCTGC -3'

Sequencing Primer
(F):5'- CCTATTAGAGGCTCTGTATTCTTGGC -3'
(R):5'- CCTTCCAGGGATCAAAACCTCTGG -3'
Posted On2015-04-06