Incidental Mutation 'R3859:Hspa14'
ID276276
Institutional Source Beutler Lab
Gene Symbol Hspa14
Ensembl Gene ENSMUSG00000109865
Gene Nameheat shock protein 14
SynonymsHsp70-4, 70kDa, NST-1, HSP70L1
MMRRC Submission 040787-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R3859 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location3488850-3512814 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 3494579 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 304 (C304*)
Ref Sequence ENSEMBL: ENSMUSP00000027961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027961]
Predicted Effect probably null
Transcript: ENSMUST00000027961
AA Change: C304*
SMART Domains Protein: ENSMUSP00000027961
Gene: ENSMUSG00000109865
AA Change: C304*

DomainStartEndE-ValueType
Pfam:HSP70 3 509 6.3e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156008
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 95% (36/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 A G 12: 84,043,444 N305S probably benign Het
Ahnak A G 19: 9,010,859 E3169G possibly damaging Het
AU022751 A G X: 6,082,656 S102P possibly damaging Het
Cav2 G T 6: 17,281,463 D35Y probably damaging Het
Cps1 A G 1: 67,168,278 Y582C probably damaging Het
Ctla2b T A 13: 60,896,043 Y128F possibly damaging Het
Dnajc5b G T 3: 19,574,802 G87* probably null Het
Erc2 A G 14: 28,475,642 probably benign Het
Fat3 G A 9: 15,997,228 Q2493* probably null Het
Fbl G A 7: 28,174,510 probably benign Het
Fbp1 C T 13: 62,865,116 G88S probably damaging Het
Fzd3 A T 14: 65,239,839 C89S possibly damaging Het
Gnao1 C T 8: 93,811,645 probably benign Het
Itih4 T C 14: 30,892,329 L412P probably damaging Het
Kdm2b A G 5: 122,880,227 L995P probably damaging Het
Krt12 G A 11: 99,418,493 L314F possibly damaging Het
Nfatc1 T C 18: 80,665,275 probably benign Het
Olfr1216 A G 2: 89,014,061 M1T probably null Het
Olfr1475 T A 19: 13,480,130 I23F possibly damaging Het
Olfr922 G A 9: 38,816,147 V215I probably benign Het
Papss1 T A 3: 131,607,335 L349Q probably benign Het
Pcdha6 C T 18: 36,969,931 P6S possibly damaging Het
Pik3r2 T C 8: 70,769,986 E487G probably damaging Het
Pkd1 A G 17: 24,578,092 probably benign Het
Prl8a9 C T 13: 27,558,164 G238E probably damaging Het
Pth2r A T 1: 65,322,047 I52F probably damaging Het
Purg T C 8: 33,386,559 F75S possibly damaging Het
Rpgrip1l T C 8: 91,263,658 T719A probably benign Het
Slc8a3 G A 12: 81,314,872 P391L probably damaging Het
Syne2 T C 12: 75,929,784 L1241P possibly damaging Het
Tdrd12 A G 7: 35,493,820 F402L possibly damaging Het
Tle4 G A 19: 14,468,213 T223I probably benign Het
Tmem2 A G 19: 21,852,234 T1236A probably benign Het
Tram2 A C 1: 21,003,980 F245V probably damaging Het
Trim30b T C 7: 104,357,280 E123G probably benign Het
Unc13c G T 9: 73,699,108 Y1323* probably null Het
Zfp2 T C 11: 50,900,096 I373M possibly damaging Het
Other mutations in Hspa14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Hspa14 APN 2 3502759 missense probably damaging 1.00
IGL02293:Hspa14 APN 2 3511034 missense probably damaging 1.00
IGL02477:Hspa14 APN 2 3496624 missense probably damaging 0.98
IGL02711:Hspa14 APN 2 3502520 missense probably benign 0.15
R0522:Hspa14 UTSW 2 3511049 missense probably damaging 1.00
R1169:Hspa14 UTSW 2 3498124 missense possibly damaging 0.90
R1426:Hspa14 UTSW 2 3508821 missense probably damaging 1.00
R1471:Hspa14 UTSW 2 3491608 missense probably benign 0.01
R1846:Hspa14 UTSW 2 3491660 missense possibly damaging 0.50
R1971:Hspa14 UTSW 2 3489767 missense possibly damaging 0.51
R2353:Hspa14 UTSW 2 3511176 splice site probably null
R3508:Hspa14 UTSW 2 3491008 missense probably damaging 1.00
R4012:Hspa14 UTSW 2 3512638 missense probably damaging 0.99
R4360:Hspa14 UTSW 2 3502523 missense possibly damaging 0.89
R4938:Hspa14 UTSW 2 3491609 missense probably benign 0.01
R5028:Hspa14 UTSW 2 3498169 missense possibly damaging 0.72
R5326:Hspa14 UTSW 2 3502523 missense possibly damaging 0.89
R5542:Hspa14 UTSW 2 3502523 missense possibly damaging 0.89
R5881:Hspa14 UTSW 2 3498170 missense probably benign 0.34
R6046:Hspa14 UTSW 2 3489764 missense possibly damaging 0.91
R6076:Hspa14 UTSW 2 3511072 missense probably benign 0.00
R6112:Hspa14 UTSW 2 3498068 missense probably benign
R6334:Hspa14 UTSW 2 3489072 unclassified probably null
R7297:Hspa14 UTSW 2 3498142 missense possibly damaging 0.76
R7424:Hspa14 UTSW 2 3489041 missense possibly damaging 0.95
R7510:Hspa14 UTSW 2 3498122 missense probably benign 0.01
R7692:Hspa14 UTSW 2 3496606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTGGGAGGGAACTAGTC -3'
(R):5'- TACTGTCGGGCATGCTGTAGAG -3'

Sequencing Primer
(F):5'- CTGGGAGGGAACTAGTCAGGTTC -3'
(R):5'- GCATGCTGTAGAGTTGCATATAAAG -3'
Posted On2015-04-06