Incidental Mutation 'R3859:Olfr1216'
ID276278
Institutional Source Beutler Lab
Gene Symbol Olfr1216
Ensembl Gene ENSMUSG00000075107
Gene Nameolfactory receptor 1216
SynonymsGA_x6K02T2Q125-50494588-50493653, MOR233-9
MMRRC Submission 040787-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R3859 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89007563-89018340 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 89014061 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000149441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099800] [ENSMUST00000216000] [ENSMUST00000217000]
Predicted Effect probably null
Transcript: ENSMUST00000099800
AA Change: M1T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097388
Gene: ENSMUSG00000075107
AA Change: M1T

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.8e-46 PFAM
Pfam:7tm_1 39 286 4.2e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216000
AA Change: M1T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably null
Transcript: ENSMUST00000217000
AA Change: M1T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218738
Meta Mutation Damage Score 0.8964 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 A G 12: 84,043,444 N305S probably benign Het
Ahnak A G 19: 9,010,859 E3169G possibly damaging Het
AU022751 A G X: 6,082,656 S102P possibly damaging Het
Cav2 G T 6: 17,281,463 D35Y probably damaging Het
Cps1 A G 1: 67,168,278 Y582C probably damaging Het
Ctla2b T A 13: 60,896,043 Y128F possibly damaging Het
Dnajc5b G T 3: 19,574,802 G87* probably null Het
Erc2 A G 14: 28,475,642 probably benign Het
Fat3 G A 9: 15,997,228 Q2493* probably null Het
Fbl G A 7: 28,174,510 probably benign Het
Fbp1 C T 13: 62,865,116 G88S probably damaging Het
Fzd3 A T 14: 65,239,839 C89S possibly damaging Het
Gnao1 C T 8: 93,811,645 probably benign Het
Hspa14 A T 2: 3,494,579 C304* probably null Het
Itih4 T C 14: 30,892,329 L412P probably damaging Het
Kdm2b A G 5: 122,880,227 L995P probably damaging Het
Krt12 G A 11: 99,418,493 L314F possibly damaging Het
Nfatc1 T C 18: 80,665,275 probably benign Het
Olfr1475 T A 19: 13,480,130 I23F possibly damaging Het
Olfr922 G A 9: 38,816,147 V215I probably benign Het
Papss1 T A 3: 131,607,335 L349Q probably benign Het
Pcdha6 C T 18: 36,969,931 P6S possibly damaging Het
Pik3r2 T C 8: 70,769,986 E487G probably damaging Het
Pkd1 A G 17: 24,578,092 probably benign Het
Prl8a9 C T 13: 27,558,164 G238E probably damaging Het
Pth2r A T 1: 65,322,047 I52F probably damaging Het
Purg T C 8: 33,386,559 F75S possibly damaging Het
Rpgrip1l T C 8: 91,263,658 T719A probably benign Het
Slc8a3 G A 12: 81,314,872 P391L probably damaging Het
Syne2 T C 12: 75,929,784 L1241P possibly damaging Het
Tdrd12 A G 7: 35,493,820 F402L possibly damaging Het
Tle4 G A 19: 14,468,213 T223I probably benign Het
Tmem2 A G 19: 21,852,234 T1236A probably benign Het
Tram2 A C 1: 21,003,980 F245V probably damaging Het
Trim30b T C 7: 104,357,280 E123G probably benign Het
Unc13c G T 9: 73,699,108 Y1323* probably null Het
Zfp2 T C 11: 50,900,096 I373M possibly damaging Het
Other mutations in Olfr1216
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Olfr1216 APN 2 89013924 missense probably benign 0.22
IGL00895:Olfr1216 APN 2 89013609 missense probably benign 0.13
IGL01634:Olfr1216 APN 2 89013444 missense probably damaging 0.99
IGL01844:Olfr1216 APN 2 89013470 missense possibly damaging 0.95
IGL02036:Olfr1216 APN 2 89013479 missense probably benign 0.00
IGL02102:Olfr1216 APN 2 89013126 utr 3 prime probably benign
IGL02194:Olfr1216 APN 2 89013887 missense probably damaging 1.00
IGL02483:Olfr1216 APN 2 89013203 missense probably damaging 1.00
IGL02745:Olfr1216 APN 2 89013888 missense probably damaging 1.00
IGL02829:Olfr1216 APN 2 89013677 missense probably damaging 1.00
IGL03113:Olfr1216 APN 2 89014035 missense probably damaging 1.00
IGL03324:Olfr1216 APN 2 89013559 nonsense probably null
R0102:Olfr1216 UTSW 2 89013671 missense probably damaging 1.00
R0304:Olfr1216 UTSW 2 89013288 missense probably damaging 1.00
R1184:Olfr1216 UTSW 2 89013713 missense probably damaging 0.99
R1484:Olfr1216 UTSW 2 89013369 nonsense probably null
R1560:Olfr1216 UTSW 2 89013206 missense probably damaging 1.00
R1823:Olfr1216 UTSW 2 89013378 missense probably benign 0.02
R1911:Olfr1216 UTSW 2 89013221 missense probably damaging 1.00
R2245:Olfr1216 UTSW 2 89013149 missense probably benign
R2331:Olfr1216 UTSW 2 89013921 missense probably benign
R4579:Olfr1216 UTSW 2 89013144 missense probably benign
R5022:Olfr1216 UTSW 2 89014043 missense probably damaging 0.96
R5353:Olfr1216 UTSW 2 89013755 missense probably benign 0.00
R5894:Olfr1216 UTSW 2 89014055 missense probably damaging 1.00
R6240:Olfr1216 UTSW 2 89013626 missense probably benign 0.03
R7101:Olfr1216 UTSW 2 89013980 missense possibly damaging 0.90
R7652:Olfr1216 UTSW 2 89013549 missense probably benign 0.01
R8243:Olfr1216 UTSW 2 89013707 missense probably benign 0.39
R8752:Olfr1216 UTSW 2 89013887 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCATGCAACAGCCAAAGG -3'
(R):5'- CACTCATAGAGGTGGATGTGTTC -3'

Sequencing Primer
(F):5'- ACCATCTTGGGTGTAACAGTAG -3'
(R):5'- CATAGAGGTGGATGTGTTCATAATC -3'
Posted On2015-04-06