Mutagenetix > Incidental Mutations

Incidental Mutation 'R3859:Pik3r2'

276289

Institutional Source

Beutler Lab

Gene Symbol

Pik3r2

Ensembl Gene

ENSMUSG00000031834

Gene Name

phosphoinositide-3-kinase regulatory subunit 2

Synonyms

p85beta

MMRRC Submission

040787-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3859 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70768176-70776713 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70769986 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 487 (E487G)

Ref Sequence

ENSEMBL: ENSMUSP00000034296 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000143785]

PDB Structure

CRYSTAL STRUCTURE OF P110BETA IN COMPLEX WITH ICSH2 OF P85BETA AND THE DRUG GDC-0941 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034296
AA Change: E487G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834
AA Change: E487G

Domain	Start	End	E-Value	Type
SH3	7	79	4e-7	SMART
RhoGAP	122	286	2.36e-18	SMART
low complexity region	291	311	N/A	INTRINSIC
SH2	322	405	4.51e-26	SMART
Pfam:PI3K_P85_iSH2	422	590	1.7e-64	PFAM
SH2	614	696	9.96e-28	SMART
low complexity region	713	718	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000034299

SMART Domains

Protein: ENSMUSP00000034299
Gene: ENSMUSG00000031838

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:GILT	60	163	4e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000143785

SMART Domains

Protein: ENSMUSP00000122065
Gene: ENSMUSG00000031834

Domain	Start	End	E-Value	Type
Blast:RhoGAP	1	30	1e-8	BLAST
Pfam:SH2	33	70	4.5e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146707

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152545

Predicted Effect

probably benign
Transcript: ENSMUST00000154685

SMART Domains

Protein: ENSMUSP00000121463
Gene: ENSMUSG00000031834

Domain	Start	End	E-Value	Type
PDB:2XS6\|A	43	84	3e-11	PDB
SCOP:d1pbwa_	47	79	6e-9	SMART
Blast:RhoGAP	58	84	4e-9	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212384

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222087

Meta Mutation Damage Score

0.1024

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

95% (36/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase (PI3K) is a lipid kinase that phosphorylates phosphatidylinositol and similar compounds, creating second messengers important in growth signaling pathways. PI3K functions as a heterodimer of a regulatory and a catalytic subunit. The protein encoded by this gene is a regulatory component of PI3K. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene have lower blood glucose levels both when fed and after fasting. Insulin sensitivity is improved as well. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot4	A	G	12: 84,043,444	N305S	probably benign	Het
Ahnak	A	G	19: 9,010,859	E3169G	possibly damaging	Het
AU022751	A	G	X: 6,082,656	S102P	possibly damaging	Het
Cav2	G	T	6: 17,281,463	D35Y	probably damaging	Het
Cps1	A	G	1: 67,168,278	Y582C	probably damaging	Het
Ctla2b	T	A	13: 60,896,043	Y128F	possibly damaging	Het
Dnajc5b	G	T	3: 19,574,802	G87*	probably null	Het
Erc2	A	G	14: 28,475,642		probably benign	Het
Fat3	G	A	9: 15,997,228	Q2493*	probably null	Het
Fbl	G	A	7: 28,174,510		probably benign	Het
Fbp1	C	T	13: 62,865,116	G88S	probably damaging	Het
Fzd3	A	T	14: 65,239,839	C89S	possibly damaging	Het
Gnao1	C	T	8: 93,811,645		probably benign	Het
Hspa14	A	T	2: 3,494,579	C304*	probably null	Het
Itih4	T	C	14: 30,892,329	L412P	probably damaging	Het
Kdm2b	A	G	5: 122,880,227	L995P	probably damaging	Het
Krt12	G	A	11: 99,418,493	L314F	possibly damaging	Het
Nfatc1	T	C	18: 80,665,275		probably benign	Het
Olfr1216	A	G	2: 89,014,061	M1T	probably null	Het
Olfr1475	T	A	19: 13,480,130	I23F	possibly damaging	Het
Olfr922	G	A	9: 38,816,147	V215I	probably benign	Het
Papss1	T	A	3: 131,607,335	L349Q	probably benign	Het
Pcdha6	C	T	18: 36,969,931	P6S	possibly damaging	Het
Pkd1	A	G	17: 24,578,092		probably benign	Het
Prl8a9	C	T	13: 27,558,164	G238E	probably damaging	Het
Pth2r	A	T	1: 65,322,047	I52F	probably damaging	Het
Purg	T	C	8: 33,386,559	F75S	possibly damaging	Het
Rpgrip1l	T	C	8: 91,263,658	T719A	probably benign	Het
Slc8a3	G	A	12: 81,314,872	P391L	probably damaging	Het
Syne2	T	C	12: 75,929,784	L1241P	possibly damaging	Het
Tdrd12	A	G	7: 35,493,820	F402L	possibly damaging	Het
Tle4	G	A	19: 14,468,213	T223I	probably benign	Het
Tmem2	A	G	19: 21,852,234	T1236A	probably benign	Het
Tram2	A	C	1: 21,003,980	F245V	probably damaging	Het
Trim30b	T	C	7: 104,357,280	E123G	probably benign	Het
Unc13c	G	T	9: 73,699,108	Y1323*	probably null	Het
Zfp2	T	C	11: 50,900,096	I373M	possibly damaging	Het

Other mutations in Pik3r2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00487:Pik3r2	APN	8	70770429	missense	probably damaging	1.00
IGL01637:Pik3r2	APN	8	70772348	unclassified	probably benign
IGL02514:Pik3r2	APN	8	70770592	missense	probably benign	0.00
IGL03395:Pik3r2	APN	8	70772355	missense	probably benign
kingfisher	UTSW	8	70770901	missense	probably damaging	1.00
R0022:Pik3r2	UTSW	8	70770901	missense	probably damaging	1.00
R0022:Pik3r2	UTSW	8	70770901	missense	probably damaging	1.00
R0448:Pik3r2	UTSW	8	70772044	unclassified	probably benign
R1636:Pik3r2	UTSW	8	70771898	missense	probably benign
R1662:Pik3r2	UTSW	8	70770606	missense	probably damaging	1.00
R2114:Pik3r2	UTSW	8	70769385	missense	probably benign	0.31
R2879:Pik3r2	UTSW	8	70772385	missense	probably benign
R3830:Pik3r2	UTSW	8	70770421	missense	probably benign	0.19
R3852:Pik3r2	UTSW	8	70770421	missense	probably benign	0.19
R3967:Pik3r2	UTSW	8	70770421	missense	probably benign	0.19
R3968:Pik3r2	UTSW	8	70770421	missense	probably benign	0.19
R3969:Pik3r2	UTSW	8	70770421	missense	probably benign	0.19
R3970:Pik3r2	UTSW	8	70770421	missense	probably benign	0.19
R4606:Pik3r2	UTSW	8	70772136	nonsense	probably null
R4666:Pik3r2	UTSW	8	70768859	missense	possibly damaging	0.93
R5481:Pik3r2	UTSW	8	70769764	missense	probably benign	0.31
R6445:Pik3r2	UTSW	8	70772026	missense	probably benign	0.01
R6578:Pik3r2	UTSW	8	70772639	missense	probably benign	0.00
R6667:Pik3r2	UTSW	8	70769173	missense	probably damaging	1.00
R6794:Pik3r2	UTSW	8	70770717	missense	probably benign	0.43
R6863:Pik3r2	UTSW	8	70770414	missense	probably damaging	1.00
R7378:Pik3r2	UTSW	8	70769381	missense	probably benign	0.03
R7750:Pik3r2	UTSW	8	70770901	missense	probably damaging	1.00
R7821:Pik3r2	UTSW	8	70769764	missense	probably damaging	1.00
R8056:Pik3r2	UTSW	8	70772367	missense	probably benign	0.14
R8237:Pik3r2	UTSW	8	70772150	missense	probably benign	0.00
R8414:Pik3r2	UTSW	8	70770435	missense	probably damaging	1.00
R8534:Pik3r2	UTSW	8	70774668	missense	probably benign
R8781:Pik3r2	UTSW	8	70769402	missense	possibly damaging	0.88
R8794:Pik3r2	UTSW	8	70771363	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGTTCAGCAGGATCCTGAGG -3'
(R):5'- GCCAGCACTATTGAAATACGG -3'

Sequencing Primer
(F):5'- CGAATTCCATTTCCAGTGATTACCAG -3'
(R):5'- GCCAGCACTATTGAAATACGGTTCTC -3'

Posted On

2015-04-06