Incidental Mutation 'R3859:Pik3r2'
ID276289
Institutional Source Beutler Lab
Gene Symbol Pik3r2
Ensembl Gene ENSMUSG00000031834
Gene Namephosphoinositide-3-kinase regulatory subunit 2
Synonymsp85beta
MMRRC Submission 040787-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3859 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location70768176-70776713 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70769986 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 487 (E487G)
Ref Sequence ENSEMBL: ENSMUSP00000034296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000143785]
PDB Structure CRYSTAL STRUCTURE OF P110BETA IN COMPLEX WITH ICSH2 OF P85BETA AND THE DRUG GDC-0941 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000034296
AA Change: E487G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834
AA Change: E487G

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000034299
SMART Domains Protein: ENSMUSP00000034299
Gene: ENSMUSG00000031838

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:GILT 60 163 4e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143785
SMART Domains Protein: ENSMUSP00000122065
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
Blast:RhoGAP 1 30 1e-8 BLAST
Pfam:SH2 33 70 4.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146707
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152545
Predicted Effect probably benign
Transcript: ENSMUST00000154685
SMART Domains Protein: ENSMUSP00000121463
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
PDB:2XS6|A 43 84 3e-11 PDB
SCOP:d1pbwa_ 47 79 6e-9 SMART
Blast:RhoGAP 58 84 4e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222087
Meta Mutation Damage Score 0.1024 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase (PI3K) is a lipid kinase that phosphorylates phosphatidylinositol and similar compounds, creating second messengers important in growth signaling pathways. PI3K functions as a heterodimer of a regulatory and a catalytic subunit. The protein encoded by this gene is a regulatory component of PI3K. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene have lower blood glucose levels both when fed and after fasting. Insulin sensitivity is improved as well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 A G 12: 84,043,444 N305S probably benign Het
Ahnak A G 19: 9,010,859 E3169G possibly damaging Het
AU022751 A G X: 6,082,656 S102P possibly damaging Het
Cav2 G T 6: 17,281,463 D35Y probably damaging Het
Cps1 A G 1: 67,168,278 Y582C probably damaging Het
Ctla2b T A 13: 60,896,043 Y128F possibly damaging Het
Dnajc5b G T 3: 19,574,802 G87* probably null Het
Erc2 A G 14: 28,475,642 probably benign Het
Fat3 G A 9: 15,997,228 Q2493* probably null Het
Fbl G A 7: 28,174,510 probably benign Het
Fbp1 C T 13: 62,865,116 G88S probably damaging Het
Fzd3 A T 14: 65,239,839 C89S possibly damaging Het
Gnao1 C T 8: 93,811,645 probably benign Het
Hspa14 A T 2: 3,494,579 C304* probably null Het
Itih4 T C 14: 30,892,329 L412P probably damaging Het
Kdm2b A G 5: 122,880,227 L995P probably damaging Het
Krt12 G A 11: 99,418,493 L314F possibly damaging Het
Nfatc1 T C 18: 80,665,275 probably benign Het
Olfr1216 A G 2: 89,014,061 M1T probably null Het
Olfr1475 T A 19: 13,480,130 I23F possibly damaging Het
Olfr922 G A 9: 38,816,147 V215I probably benign Het
Papss1 T A 3: 131,607,335 L349Q probably benign Het
Pcdha6 C T 18: 36,969,931 P6S possibly damaging Het
Pkd1 A G 17: 24,578,092 probably benign Het
Prl8a9 C T 13: 27,558,164 G238E probably damaging Het
Pth2r A T 1: 65,322,047 I52F probably damaging Het
Purg T C 8: 33,386,559 F75S possibly damaging Het
Rpgrip1l T C 8: 91,263,658 T719A probably benign Het
Slc8a3 G A 12: 81,314,872 P391L probably damaging Het
Syne2 T C 12: 75,929,784 L1241P possibly damaging Het
Tdrd12 A G 7: 35,493,820 F402L possibly damaging Het
Tle4 G A 19: 14,468,213 T223I probably benign Het
Tmem2 A G 19: 21,852,234 T1236A probably benign Het
Tram2 A C 1: 21,003,980 F245V probably damaging Het
Trim30b T C 7: 104,357,280 E123G probably benign Het
Unc13c G T 9: 73,699,108 Y1323* probably null Het
Zfp2 T C 11: 50,900,096 I373M possibly damaging Het
Other mutations in Pik3r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Pik3r2 APN 8 70770429 missense probably damaging 1.00
IGL01637:Pik3r2 APN 8 70772348 unclassified probably benign
IGL02514:Pik3r2 APN 8 70770592 missense probably benign 0.00
IGL03395:Pik3r2 APN 8 70772355 missense probably benign
kingfisher UTSW 8 70770901 missense probably damaging 1.00
R0022:Pik3r2 UTSW 8 70770901 missense probably damaging 1.00
R0022:Pik3r2 UTSW 8 70770901 missense probably damaging 1.00
R0448:Pik3r2 UTSW 8 70772044 unclassified probably benign
R1636:Pik3r2 UTSW 8 70771898 missense probably benign
R1662:Pik3r2 UTSW 8 70770606 missense probably damaging 1.00
R2114:Pik3r2 UTSW 8 70769385 missense probably benign 0.31
R2879:Pik3r2 UTSW 8 70772385 missense probably benign
R3830:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3852:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3967:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3968:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3969:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3970:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R4606:Pik3r2 UTSW 8 70772136 nonsense probably null
R4666:Pik3r2 UTSW 8 70768859 missense possibly damaging 0.93
R5481:Pik3r2 UTSW 8 70769764 missense probably benign 0.31
R6445:Pik3r2 UTSW 8 70772026 missense probably benign 0.01
R6578:Pik3r2 UTSW 8 70772639 missense probably benign 0.00
R6667:Pik3r2 UTSW 8 70769173 missense probably damaging 1.00
R6794:Pik3r2 UTSW 8 70770717 missense probably benign 0.43
R6863:Pik3r2 UTSW 8 70770414 missense probably damaging 1.00
R7378:Pik3r2 UTSW 8 70769381 missense probably benign 0.03
R7750:Pik3r2 UTSW 8 70770901 missense probably damaging 1.00
R7821:Pik3r2 UTSW 8 70769764 missense probably damaging 1.00
R8056:Pik3r2 UTSW 8 70772367 missense probably benign 0.14
R8237:Pik3r2 UTSW 8 70772150 missense probably benign 0.00
R8414:Pik3r2 UTSW 8 70770435 missense probably damaging 1.00
R8534:Pik3r2 UTSW 8 70774668 missense probably benign
R8781:Pik3r2 UTSW 8 70769402 missense possibly damaging 0.88
R8794:Pik3r2 UTSW 8 70771363 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTTCAGCAGGATCCTGAGG -3'
(R):5'- GCCAGCACTATTGAAATACGG -3'

Sequencing Primer
(F):5'- CGAATTCCATTTCCAGTGATTACCAG -3'
(R):5'- GCCAGCACTATTGAAATACGGTTCTC -3'
Posted On2015-04-06