Incidental Mutation 'R3859:Tle4'
ID276313
Institutional Source Beutler Lab
Gene Symbol Tle4
Ensembl Gene ENSMUSG00000024642
Gene Nametransducin-like enhancer of split 4
SynonymsBce1, ESTM14, 5730411M05Rik, Grg4, ESTM13
MMRRC Submission 040787-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3859 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location14448072-14598051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 14468213 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 223 (T223I)
Ref Sequence ENSEMBL: ENSMUSP00000126249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052011] [ENSMUST00000167776]
Predicted Effect probably benign
Transcript: ENSMUST00000052011
AA Change: T223I

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000057527
Gene: ENSMUSG00000024642
AA Change: T223I

DomainStartEndE-ValueType
Pfam:TLE_N 8 138 9.1e-76 PFAM
low complexity region 164 178 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
low complexity region 226 238 N/A INTRINSIC
low complexity region 289 316 N/A INTRINSIC
WD40 477 514 4.18e-2 SMART
WD40 520 561 3.64e-2 SMART
WD40 566 605 9.38e-5 SMART
WD40 608 647 1.14e-8 SMART
WD40 650 688 2.29e1 SMART
WD40 690 729 7.39e-3 SMART
WD40 730 770 4.14e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167776
AA Change: T223I

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000126249
Gene: ENSMUSG00000024642
AA Change: T223I

DomainStartEndE-ValueType
Pfam:TLE_N 8 138 5.1e-76 PFAM
low complexity region 164 178 N/A INTRINSIC
low complexity region 199 216 N/A INTRINSIC
low complexity region 226 238 N/A INTRINSIC
low complexity region 289 316 N/A INTRINSIC
WD40 477 514 4.18e-2 SMART
WD40 520 561 3.64e-2 SMART
WD40 566 605 9.38e-5 SMART
WD40 608 647 1.14e-8 SMART
WD40 650 688 2.29e1 SMART
WD40 690 729 7.39e-3 SMART
WD40 730 770 4.14e-1 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 95% (36/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are runted and die around 4 weeks of age with leukocytopenia, B cell lymphopenia, reduced bone mineralization and reduced hematopoietic stem cell number and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 A G 12: 84,043,444 N305S probably benign Het
Ahnak A G 19: 9,010,859 E3169G possibly damaging Het
AU022751 A G X: 6,082,656 S102P possibly damaging Het
Cav2 G T 6: 17,281,463 D35Y probably damaging Het
Cps1 A G 1: 67,168,278 Y582C probably damaging Het
Ctla2b T A 13: 60,896,043 Y128F possibly damaging Het
Dnajc5b G T 3: 19,574,802 G87* probably null Het
Erc2 A G 14: 28,475,642 probably benign Het
Fat3 G A 9: 15,997,228 Q2493* probably null Het
Fbl G A 7: 28,174,510 probably benign Het
Fbp1 C T 13: 62,865,116 G88S probably damaging Het
Fzd3 A T 14: 65,239,839 C89S possibly damaging Het
Gnao1 C T 8: 93,811,645 probably benign Het
Hspa14 A T 2: 3,494,579 C304* probably null Het
Itih4 T C 14: 30,892,329 L412P probably damaging Het
Kdm2b A G 5: 122,880,227 L995P probably damaging Het
Krt12 G A 11: 99,418,493 L314F possibly damaging Het
Nfatc1 T C 18: 80,665,275 probably benign Het
Olfr1216 A G 2: 89,014,061 M1T probably null Het
Olfr1475 T A 19: 13,480,130 I23F possibly damaging Het
Olfr922 G A 9: 38,816,147 V215I probably benign Het
Papss1 T A 3: 131,607,335 L349Q probably benign Het
Pcdha6 C T 18: 36,969,931 P6S possibly damaging Het
Pik3r2 T C 8: 70,769,986 E487G probably damaging Het
Pkd1 A G 17: 24,578,092 probably benign Het
Prl8a9 C T 13: 27,558,164 G238E probably damaging Het
Pth2r A T 1: 65,322,047 I52F probably damaging Het
Purg T C 8: 33,386,559 F75S possibly damaging Het
Rpgrip1l T C 8: 91,263,658 T719A probably benign Het
Slc8a3 G A 12: 81,314,872 P391L probably damaging Het
Syne2 T C 12: 75,929,784 L1241P possibly damaging Het
Tdrd12 A G 7: 35,493,820 F402L possibly damaging Het
Tmem2 A G 19: 21,852,234 T1236A probably benign Het
Tram2 A C 1: 21,003,980 F245V probably damaging Het
Trim30b T C 7: 104,357,280 E123G probably benign Het
Unc13c G T 9: 73,699,108 Y1323* probably null Het
Zfp2 T C 11: 50,900,096 I373M possibly damaging Het
Other mutations in Tle4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Tle4 APN 19 14468261 missense probably benign 0.00
IGL01449:Tle4 APN 19 14465340 missense probably benign 0.00
IGL01618:Tle4 APN 19 14544814 missense probably benign 0.07
IGL01636:Tle4 APN 19 14452533 missense probably damaging 0.97
IGL01750:Tle4 APN 19 14449789 missense probably damaging 1.00
IGL02376:Tle4 APN 19 14594404 missense probably damaging 1.00
R0006:Tle4 UTSW 19 14466714 splice site probably benign
R1068:Tle4 UTSW 19 14452179 missense probably damaging 1.00
R1174:Tle4 UTSW 19 14468262 missense probably benign
R1594:Tle4 UTSW 19 14453606 nonsense probably null
R1671:Tle4 UTSW 19 14453739 missense probably damaging 1.00
R1891:Tle4 UTSW 19 14544786 critical splice donor site probably null
R1951:Tle4 UTSW 19 14516357 critical splice donor site probably null
R2068:Tle4 UTSW 19 14449749 nonsense probably null
R3858:Tle4 UTSW 19 14468213 missense probably benign 0.11
R3946:Tle4 UTSW 19 14597388 missense probably damaging 0.98
R4357:Tle4 UTSW 19 14468261 missense probably benign 0.00
R4395:Tle4 UTSW 19 14517938 missense probably benign 0.20
R4491:Tle4 UTSW 19 14454865 missense probably damaging 1.00
R4860:Tle4 UTSW 19 14464345 missense probably benign 0.30
R4860:Tle4 UTSW 19 14464345 missense probably benign 0.30
R5336:Tle4 UTSW 19 14454739 critical splice donor site probably null
R5516:Tle4 UTSW 19 14454889 missense probably damaging 0.99
R5611:Tle4 UTSW 19 14449795 missense probably damaging 1.00
R6032:Tle4 UTSW 19 14452108 missense possibly damaging 0.74
R6032:Tle4 UTSW 19 14452108 missense possibly damaging 0.74
R6113:Tle4 UTSW 19 14595588 critical splice donor site probably null
R6513:Tle4 UTSW 19 14451692 missense probably damaging 0.99
R6995:Tle4 UTSW 19 14564453 critical splice acceptor site probably null
R7175:Tle4 UTSW 19 14451707 missense probably damaging 1.00
R7310:Tle4 UTSW 19 14517791 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GATGGCAATAGCTTTGATACACAG -3'
(R):5'- ATCTGCCCTCTGGGTTGTAC -3'

Sequencing Primer
(F):5'- GCTTTGATACACAGATAAAAACACAG -3'
(R):5'- CTGGGTTGTACTCATCCTACTG -3'
Posted On2015-04-06