Incidental Mutation 'R3861:Rccd1'
ID276344
Institutional Source Beutler Lab
Gene Symbol Rccd1
Ensembl Gene ENSMUSG00000038930
Gene NameRCC1 domain containing 1
Synonyms
MMRRC Submission 040788-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3861 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location80293229-80324454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80320368 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 167 (E167G)
Ref Sequence ENSEMBL: ENSMUSP00000113273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032748] [ENSMUST00000047362] [ENSMUST00000047558] [ENSMUST00000107368] [ENSMUST00000121882] [ENSMUST00000123189] [ENSMUST00000173824] [ENSMUST00000174199] [ENSMUST00000163812] [ENSMUST00000154428] [ENSMUST00000174172]
Predicted Effect probably benign
Transcript: ENSMUST00000032748
SMART Domains Protein: ENSMUSP00000032748
Gene: ENSMUSG00000030533

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 6e-9 BLAST
Blast:ARM 226 266 1e-7 BLAST
Pfam:UNC45-central 287 505 1.2e-43 PFAM
Blast:ARM 679 717 4e-13 BLAST
Blast:ARM 720 762 4e-12 BLAST
Blast:ARM 764 804 8e-16 BLAST
low complexity region 833 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047362
AA Change: E167G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000048043
Gene: ENSMUSG00000038930
AA Change: E167G

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:RCC1 179 228 2.9e-17 PFAM
Pfam:RCC1_2 215 244 1.3e-10 PFAM
Pfam:RCC1 231 316 7.8e-9 PFAM
Pfam:RCC1_2 303 332 3.3e-10 PFAM
Pfam:RCC1 319 370 4.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047558
SMART Domains Protein: ENSMUSP00000043379
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
internal_repeat_1 22 36 1.45e-5 PROSPERO
Pfam:MAP65_ASE1 37 602 5.3e-172 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107368
SMART Domains Protein: ENSMUSP00000102991
Gene: ENSMUSG00000030533

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 6e-9 BLAST
Blast:ARM 226 266 1e-7 BLAST
Pfam:UNC45-central 314 505 2.4e-38 PFAM
Blast:ARM 679 717 4e-13 BLAST
Blast:ARM 720 762 4e-12 BLAST
Blast:ARM 764 804 8e-16 BLAST
low complexity region 833 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121882
AA Change: E167G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113273
Gene: ENSMUSG00000038930
AA Change: E167G

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:RCC1 179 228 7.4e-18 PFAM
Pfam:RCC1_2 216 244 5.5e-10 PFAM
Pfam:RCC1_2 304 332 6.2e-10 PFAM
Pfam:RCC1 319 370 1.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123109
Predicted Effect probably benign
Transcript: ENSMUST00000123189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155124
Predicted Effect probably benign
Transcript: ENSMUST00000206363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205863
Predicted Effect probably benign
Transcript: ENSMUST00000173824
SMART Domains Protein: ENSMUSP00000133910
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
internal_repeat_1 22 36 8.71e-6 PROSPERO
Pfam:MAP65_ASE1 37 565 6e-168 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174199
SMART Domains Protein: ENSMUSP00000133295
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 7 524 8.1e-158 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163812
SMART Domains Protein: ENSMUSP00000129675
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
internal_repeat_1 22 36 1.51e-5 PROSPERO
Pfam:MAP65_ASE1 37 605 1.9e-173 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154428
SMART Domains Protein: ENSMUSP00000119665
Gene: ENSMUSG00000030533

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 4e-9 BLAST
Blast:ARM 226 266 6e-8 BLAST
Pfam:UNC45-central 287 505 3.5e-44 PFAM
low complexity region 597 608 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174111
Predicted Effect probably benign
Transcript: ENSMUST00000174172
SMART Domains Protein: ENSMUSP00000133387
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 34 615 2.9e-167 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174051
SMART Domains Protein: ENSMUSP00000134262
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 1 244 1.9e-55 PFAM
Meta Mutation Damage Score 0.1368 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik G A 12: 18,533,410 S157N probably benign Het
A830018L16Rik T C 1: 11,588,554 probably benign Het
Akip1 C T 7: 109,707,406 probably benign Het
Anxa5 T C 3: 36,450,658 T252A probably benign Het
Arhgef10l A G 4: 140,515,487 F1072L possibly damaging Het
Armc1 C T 3: 19,135,032 R186Q probably damaging Het
Atxn2l A T 7: 126,501,951 probably null Het
Cadps2 A G 6: 23,355,861 I849T probably damaging Het
Ccdc28a T A 10: 18,224,995 Q28L probably damaging Het
Cdh4 T A 2: 179,874,097 V356D probably damaging Het
Chd8 T A 14: 52,237,121 Q151L probably benign Het
Chgb T A 2: 132,793,144 H335Q probably damaging Het
Col19a1 G A 1: 24,326,017 P506S probably damaging Het
Col5a2 T C 1: 45,380,237 T1228A probably damaging Het
Cpxm2 A G 7: 132,054,919 V538A probably benign Het
Cramp1l A T 17: 24,997,614 probably benign Het
Cttnbp2 T C 6: 18,423,833 R831G probably benign Het
Cyp4f17 A G 17: 32,528,104 D436G probably damaging Het
Dcaf6 A T 1: 165,429,269 N48K probably damaging Het
Ddx50 C A 10: 62,642,946 V154L possibly damaging Het
Dnah9 T C 11: 66,052,994 probably benign Het
Dnm3 T A 1: 162,311,405 I395L possibly damaging Het
Elp2 C T 18: 24,606,920 R68C probably benign Het
Frg1 A T 8: 41,407,783 probably null Het
Fsip2 G T 2: 82,984,776 D3618Y probably damaging Het
Gabra2 T C 5: 70,973,543 D314G probably damaging Het
Gm906 T C 13: 50,246,851 K480E probably benign Het
Gramd1a A C 7: 31,135,940 D407E possibly damaging Het
Grm5 T A 7: 88,129,994 S881T possibly damaging Het
Ikbkb T A 8: 22,678,836 I216F possibly damaging Het
Kif3a T C 11: 53,597,978 V634A probably benign Het
Ltbp1 A T 17: 75,359,338 Y1342F possibly damaging Het
Mia2 G T 12: 59,109,021 V508L probably benign Het
Mtus2 C T 5: 148,313,413 T155M probably damaging Het
Napepld A T 5: 21,683,289 V54E probably benign Het
Nlrc4 T C 17: 74,445,621 E589G probably benign Het
Nphp3 G T 9: 104,039,326 probably benign Het
Nr2f1 T A 13: 78,195,675 R10* probably null Het
Nsfl1c C A 2: 151,510,904 probably null Het
Olfr304 A G 7: 86,386,123 V179A possibly damaging Het
Pcdhgc3 A G 18: 37,808,528 T661A probably damaging Het
Pdzrn3 A G 6: 101,172,371 V332A possibly damaging Het
Pkhd1 C T 1: 20,200,927 C3134Y probably damaging Het
Ptprz1 T C 6: 23,036,895 V1131A probably damaging Het
Ror1 T C 4: 100,407,923 I198T possibly damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scly C T 1: 91,302,851 probably benign Het
Scn4a T C 11: 106,326,124 probably benign Het
Sh3rf2 T C 18: 42,153,319 S594P probably damaging Het
Slc19a1 G A 10: 77,041,975 V115M possibly damaging Het
Slc26a6 A T 9: 108,854,196 probably benign Het
Smg7 C T 1: 152,852,598 R439K probably null Het
Syne2 A G 12: 75,966,479 R2815G probably damaging Het
Tmem55a A G 4: 14,902,506 N169S probably damaging Het
Trim75 G A 8: 64,982,827 R324C probably damaging Het
Ucp3 T C 7: 100,480,251 S98P probably benign Het
Zscan29 G C 2: 121,160,731 R859G probably benign Het
Other mutations in Rccd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01915:Rccd1 APN 7 80320218 unclassified probably benign
IGL02024:Rccd1 APN 7 80319007 missense probably benign 0.00
IGL02747:Rccd1 APN 7 80320490 missense probably benign 0.31
IGL02936:Rccd1 APN 7 80317046 missense probably damaging 0.97
K3955:Rccd1 UTSW 7 80320671 missense probably benign 0.04
R0137:Rccd1 UTSW 7 80320578 missense possibly damaging 0.46
R0671:Rccd1 UTSW 7 80320217 unclassified probably benign
R0909:Rccd1 UTSW 7 80319051 splice site probably null
R1588:Rccd1 UTSW 7 80320111 nonsense probably null
R1706:Rccd1 UTSW 7 80320663 missense possibly damaging 0.79
R1826:Rccd1 UTSW 7 80320218 unclassified probably benign
R1934:Rccd1 UTSW 7 80320524 missense possibly damaging 0.64
R2983:Rccd1 UTSW 7 80320528 nonsense probably null
R7387:Rccd1 UTSW 7 80320602 missense probably benign 0.26
R7967:Rccd1 UTSW 7 80318909 missense possibly damaging 0.86
R8338:Rccd1 UTSW 7 80320870 missense possibly damaging 0.91
X0022:Rccd1 UTSW 7 80320567 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ACAGTCTTGGCTCTAGTTCTG -3'
(R):5'- GGTACCAGGTTCTGCGTTAC -3'

Sequencing Primer
(F):5'- GGCTCTAGTTCTGCCTCCAG -3'
(R):5'- TGCGTTACAGGGGGAGC -3'
Posted On2015-04-06