Incidental Mutation 'R3861:Frg1'
ID276352
Institutional Source Beutler Lab
Gene Symbol Frg1
Ensembl Gene ENSMUSG00000031590
Gene NameFSHD region gene 1
Synonyms
MMRRC Submission 040788-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R3861 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location41397459-41417074 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 41407783 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033999]
PDB Structure
Solution structure of mouse FRG1 protein [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000033999
SMART Domains Protein: ENSMUSP00000033999
Gene: ENSMUSG00000031590

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
Pfam:FRG1 67 256 4.2e-82 PFAM
Pfam:Fascin 92 180 3.6e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210873
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene maps to a location 100 kb centromeric of the repeat units on chromosome 4q35 which are deleted in facioscapulohumeral muscular dystrophy (FSHD). It is evolutionarily conserved and has related sequences on multiple human chromosomes but DNA sequence analysis did not reveal any homology to known genes. In vivo studies demonstrate the encoded protein is localized to the nucleolus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik G A 12: 18,533,410 S157N probably benign Het
A830018L16Rik T C 1: 11,588,554 probably benign Het
Akip1 C T 7: 109,707,406 probably benign Het
Anxa5 T C 3: 36,450,658 T252A probably benign Het
Arhgef10l A G 4: 140,515,487 F1072L possibly damaging Het
Armc1 C T 3: 19,135,032 R186Q probably damaging Het
Atxn2l A T 7: 126,501,951 probably null Het
Cadps2 A G 6: 23,355,861 I849T probably damaging Het
Ccdc28a T A 10: 18,224,995 Q28L probably damaging Het
Cdh4 T A 2: 179,874,097 V356D probably damaging Het
Chd8 T A 14: 52,237,121 Q151L probably benign Het
Chgb T A 2: 132,793,144 H335Q probably damaging Het
Col19a1 G A 1: 24,326,017 P506S probably damaging Het
Col5a2 T C 1: 45,380,237 T1228A probably damaging Het
Cpxm2 A G 7: 132,054,919 V538A probably benign Het
Cramp1l A T 17: 24,997,614 probably benign Het
Cttnbp2 T C 6: 18,423,833 R831G probably benign Het
Cyp4f17 A G 17: 32,528,104 D436G probably damaging Het
Dcaf6 A T 1: 165,429,269 N48K probably damaging Het
Ddx50 C A 10: 62,642,946 V154L possibly damaging Het
Dnah9 T C 11: 66,052,994 probably benign Het
Dnm3 T A 1: 162,311,405 I395L possibly damaging Het
Elp2 C T 18: 24,606,920 R68C probably benign Het
Fsip2 G T 2: 82,984,776 D3618Y probably damaging Het
Gabra2 T C 5: 70,973,543 D314G probably damaging Het
Gm906 T C 13: 50,246,851 K480E probably benign Het
Gramd1a A C 7: 31,135,940 D407E possibly damaging Het
Grm5 T A 7: 88,129,994 S881T possibly damaging Het
Ikbkb T A 8: 22,678,836 I216F possibly damaging Het
Kif3a T C 11: 53,597,978 V634A probably benign Het
Ltbp1 A T 17: 75,359,338 Y1342F possibly damaging Het
Mia2 G T 12: 59,109,021 V508L probably benign Het
Mtus2 C T 5: 148,313,413 T155M probably damaging Het
Napepld A T 5: 21,683,289 V54E probably benign Het
Nlrc4 T C 17: 74,445,621 E589G probably benign Het
Nphp3 G T 9: 104,039,326 probably benign Het
Nr2f1 T A 13: 78,195,675 R10* probably null Het
Nsfl1c C A 2: 151,510,904 probably null Het
Olfr304 A G 7: 86,386,123 V179A possibly damaging Het
Pcdhgc3 A G 18: 37,808,528 T661A probably damaging Het
Pdzrn3 A G 6: 101,172,371 V332A possibly damaging Het
Pkhd1 C T 1: 20,200,927 C3134Y probably damaging Het
Ptprz1 T C 6: 23,036,895 V1131A probably damaging Het
Rccd1 T C 7: 80,320,368 E167G probably benign Het
Ror1 T C 4: 100,407,923 I198T possibly damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scly C T 1: 91,302,851 probably benign Het
Scn4a T C 11: 106,326,124 probably benign Het
Sh3rf2 T C 18: 42,153,319 S594P probably damaging Het
Slc19a1 G A 10: 77,041,975 V115M possibly damaging Het
Slc26a6 A T 9: 108,854,196 probably benign Het
Smg7 C T 1: 152,852,598 R439K probably null Het
Syne2 A G 12: 75,966,479 R2815G probably damaging Het
Tmem55a A G 4: 14,902,506 N169S probably damaging Het
Trim75 G A 8: 64,982,827 R324C probably damaging Het
Ucp3 T C 7: 100,480,251 S98P probably benign Het
Zscan29 G C 2: 121,160,731 R859G probably benign Het
Other mutations in Frg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01541:Frg1 APN 8 41410325 splice site probably benign
IGL01562:Frg1 APN 8 41416909 missense possibly damaging 0.92
IGL03148:Frg1 APN 8 41411284 missense probably benign 0.00
R0180:Frg1 UTSW 8 41399068 critical splice acceptor site probably null
R1146:Frg1 UTSW 8 41411217 splice site probably benign
R2427:Frg1 UTSW 8 41414866 missense probably damaging 1.00
R4672:Frg1 UTSW 8 41400809 missense probably benign 0.30
R5981:Frg1 UTSW 8 41410270 missense possibly damaging 0.93
R7672:Frg1 UTSW 8 41417003 start gained probably benign
Z1176:Frg1 UTSW 8 41399638 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAACAAGCCACTGTAGTAGTATTG -3'
(R):5'- ACAGATAGAGAATACAGTGTCCAC -3'

Sequencing Primer
(F):5'- AAGCCACTGTAGTAGTATTGTTGTTG -3'
(R):5'- GTCCACTATAAACATATCTGGTCTGG -3'
Posted On2015-04-06