Incidental Mutation 'R3861:Ccdc28a'
ID276357
Institutional Source Beutler Lab
Gene Symbol Ccdc28a
Ensembl Gene ENSMUSG00000059554
Gene Namecoiled-coil domain containing 28A
Synonyms1700009P13Rik
MMRRC Submission 040788-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3861 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location18213676-18234998 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18224995 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 28 (Q28L)
Ref Sequence ENSEMBL: ENSMUSP00000134307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052648] [ENSMUST00000080860] [ENSMUST00000173243] [ENSMUST00000174592]
Predicted Effect probably damaging
Transcript: ENSMUST00000052648
AA Change: Q75L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000050107
Gene: ENSMUSG00000059554
AA Change: Q75L

DomainStartEndE-ValueType
low complexity region 56 68 N/A INTRINSIC
Pfam:DUF4061 83 173 6.8e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080860
AA Change: Q75L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079671
Gene: ENSMUSG00000059554
AA Change: Q75L

DomainStartEndE-ValueType
low complexity region 56 68 N/A INTRINSIC
Pfam:DUF4061 82 169 2.1e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173243
AA Change: Q21L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133585
Gene: ENSMUSG00000059554
AA Change: Q21L

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:DUF4061 28 115 1.3e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174592
AA Change: Q28L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134307
Gene: ENSMUSG00000059554
AA Change: Q28L

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
Pfam:DUF4061 35 122 9.2e-41 PFAM
Meta Mutation Damage Score 0.2598 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain containing protein. Although the specific function of this gene has not yet been determined, this gene is a known translocation partner of nucleoporin 98 in acute leukemias. The resulting fusion gene produces a nucleoporin 98-coiled-coil domain-containing protein 28A chimeric protein which may be involved in promoting myeloproliferative neoplasms. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik G A 12: 18,533,410 S157N probably benign Het
A830018L16Rik T C 1: 11,588,554 probably benign Het
Akip1 C T 7: 109,707,406 probably benign Het
Anxa5 T C 3: 36,450,658 T252A probably benign Het
Arhgef10l A G 4: 140,515,487 F1072L possibly damaging Het
Armc1 C T 3: 19,135,032 R186Q probably damaging Het
Atxn2l A T 7: 126,501,951 probably null Het
Cadps2 A G 6: 23,355,861 I849T probably damaging Het
Cdh4 T A 2: 179,874,097 V356D probably damaging Het
Chd8 T A 14: 52,237,121 Q151L probably benign Het
Chgb T A 2: 132,793,144 H335Q probably damaging Het
Col19a1 G A 1: 24,326,017 P506S probably damaging Het
Col5a2 T C 1: 45,380,237 T1228A probably damaging Het
Cpxm2 A G 7: 132,054,919 V538A probably benign Het
Cramp1l A T 17: 24,997,614 probably benign Het
Cttnbp2 T C 6: 18,423,833 R831G probably benign Het
Cyp4f17 A G 17: 32,528,104 D436G probably damaging Het
Dcaf6 A T 1: 165,429,269 N48K probably damaging Het
Ddx50 C A 10: 62,642,946 V154L possibly damaging Het
Dnah9 T C 11: 66,052,994 probably benign Het
Dnm3 T A 1: 162,311,405 I395L possibly damaging Het
Elp2 C T 18: 24,606,920 R68C probably benign Het
Frg1 A T 8: 41,407,783 probably null Het
Fsip2 G T 2: 82,984,776 D3618Y probably damaging Het
Gabra2 T C 5: 70,973,543 D314G probably damaging Het
Gm906 T C 13: 50,246,851 K480E probably benign Het
Gramd1a A C 7: 31,135,940 D407E possibly damaging Het
Grm5 T A 7: 88,129,994 S881T possibly damaging Het
Ikbkb T A 8: 22,678,836 I216F possibly damaging Het
Kif3a T C 11: 53,597,978 V634A probably benign Het
Ltbp1 A T 17: 75,359,338 Y1342F possibly damaging Het
Mia2 G T 12: 59,109,021 V508L probably benign Het
Mtus2 C T 5: 148,313,413 T155M probably damaging Het
Napepld A T 5: 21,683,289 V54E probably benign Het
Nlrc4 T C 17: 74,445,621 E589G probably benign Het
Nphp3 G T 9: 104,039,326 probably benign Het
Nr2f1 T A 13: 78,195,675 R10* probably null Het
Nsfl1c C A 2: 151,510,904 probably null Het
Olfr304 A G 7: 86,386,123 V179A possibly damaging Het
Pcdhgc3 A G 18: 37,808,528 T661A probably damaging Het
Pdzrn3 A G 6: 101,172,371 V332A possibly damaging Het
Pkhd1 C T 1: 20,200,927 C3134Y probably damaging Het
Ptprz1 T C 6: 23,036,895 V1131A probably damaging Het
Rccd1 T C 7: 80,320,368 E167G probably benign Het
Ror1 T C 4: 100,407,923 I198T possibly damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scly C T 1: 91,302,851 probably benign Het
Scn4a T C 11: 106,326,124 probably benign Het
Sh3rf2 T C 18: 42,153,319 S594P probably damaging Het
Slc19a1 G A 10: 77,041,975 V115M possibly damaging Het
Slc26a6 A T 9: 108,854,196 probably benign Het
Smg7 C T 1: 152,852,598 R439K probably null Het
Syne2 A G 12: 75,966,479 R2815G probably damaging Het
Tmem55a A G 4: 14,902,506 N169S probably damaging Het
Trim75 G A 8: 64,982,827 R324C probably damaging Het
Ucp3 T C 7: 100,480,251 S98P probably benign Het
Zscan29 G C 2: 121,160,731 R859G probably benign Het
Other mutations in Ccdc28a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Ccdc28a APN 10 18230513 missense possibly damaging 0.85
IGL01806:Ccdc28a APN 10 18219514 missense possibly damaging 0.62
IGL02403:Ccdc28a APN 10 18214183 splice site probably benign
IGL02547:Ccdc28a APN 10 18214146 missense possibly damaging 0.67
R0139:Ccdc28a UTSW 10 18230440 missense possibly damaging 0.92
R0608:Ccdc28a UTSW 10 18224951 missense probably damaging 1.00
R2157:Ccdc28a UTSW 10 18230455 missense probably benign 0.13
R4254:Ccdc28a UTSW 10 18224935 missense probably damaging 1.00
R5621:Ccdc28a UTSW 10 18216268 missense probably benign 0.13
R5704:Ccdc28a UTSW 10 18230572 missense probably damaging 1.00
R6216:Ccdc28a UTSW 10 18224971 nonsense probably null
R7905:Ccdc28a UTSW 10 18218328 missense probably benign 0.12
R7981:Ccdc28a UTSW 10 18218379 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTTGGCTTTCACGTGCACAC -3'
(R):5'- GGCTACACTTTGTACAGGTGAG -3'

Sequencing Primer
(F):5'- CACAGAACATAGCCAACTAGAGGAAG -3'
(R):5'- TGCGAGATCTAACCAAGG -3'
Posted On2015-04-06