Incidental Mutation 'R3861:Scn4a'
ID276364
Institutional Source Beutler Lab
Gene Symbol Scn4a
Ensembl Gene ENSMUSG00000001027
Gene Namesodium channel, voltage-gated, type IV, alpha
SynonymsSkM1, mH2, Nav1.4
MMRRC Submission 040788-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3861 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location106318592-106353288 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 106326124 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021056]
Predicted Effect probably benign
Transcript: ENSMUST00000021056
SMART Domains Protein: ENSMUSP00000021056
Gene: ENSMUSG00000001027

DomainStartEndE-ValueType
Pfam:Ion_trans 130 452 1.1e-80 PFAM
low complexity region 473 491 N/A INTRINSIC
Pfam:Ion_trans 571 805 4.2e-56 PFAM
Pfam:Na_trans_assoc 810 1020 3.2e-59 PFAM
Pfam:Ion_trans 1024 1299 1.4e-64 PFAM
Pfam:Ion_trans 1346 1603 6.1e-55 PFAM
Pfam:PKD_channel 1441 1598 1.4e-6 PFAM
IQ 1720 1742 2.5e-2 SMART
low complexity region 1815 1827 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. It is expressed in skeletal muscle, and mutations in this gene have been linked to several myotonia and periodic paralysis disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous or homozygous for a knock-in allele develop myotonia, increased myofiber damage, K+-sensitive paralysis and susceptibility to delayed weakness during recovery from fatigue. Homozygotes show perinatal lethality, low survival rate, unusual hind-limb clasping and reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik G A 12: 18,533,410 S157N probably benign Het
A830018L16Rik T C 1: 11,588,554 probably benign Het
Akip1 C T 7: 109,707,406 probably benign Het
Anxa5 T C 3: 36,450,658 T252A probably benign Het
Arhgef10l A G 4: 140,515,487 F1072L possibly damaging Het
Armc1 C T 3: 19,135,032 R186Q probably damaging Het
Atxn2l A T 7: 126,501,951 probably null Het
Cadps2 A G 6: 23,355,861 I849T probably damaging Het
Ccdc28a T A 10: 18,224,995 Q28L probably damaging Het
Cdh4 T A 2: 179,874,097 V356D probably damaging Het
Chd8 T A 14: 52,237,121 Q151L probably benign Het
Chgb T A 2: 132,793,144 H335Q probably damaging Het
Col19a1 G A 1: 24,326,017 P506S probably damaging Het
Col5a2 T C 1: 45,380,237 T1228A probably damaging Het
Cpxm2 A G 7: 132,054,919 V538A probably benign Het
Cramp1l A T 17: 24,997,614 probably benign Het
Cttnbp2 T C 6: 18,423,833 R831G probably benign Het
Cyp4f17 A G 17: 32,528,104 D436G probably damaging Het
Dcaf6 A T 1: 165,429,269 N48K probably damaging Het
Ddx50 C A 10: 62,642,946 V154L possibly damaging Het
Dnah9 T C 11: 66,052,994 probably benign Het
Dnm3 T A 1: 162,311,405 I395L possibly damaging Het
Elp2 C T 18: 24,606,920 R68C probably benign Het
Frg1 A T 8: 41,407,783 probably null Het
Fsip2 G T 2: 82,984,776 D3618Y probably damaging Het
Gabra2 T C 5: 70,973,543 D314G probably damaging Het
Gm906 T C 13: 50,246,851 K480E probably benign Het
Gramd1a A C 7: 31,135,940 D407E possibly damaging Het
Grm5 T A 7: 88,129,994 S881T possibly damaging Het
Ikbkb T A 8: 22,678,836 I216F possibly damaging Het
Kif3a T C 11: 53,597,978 V634A probably benign Het
Ltbp1 A T 17: 75,359,338 Y1342F possibly damaging Het
Mia2 G T 12: 59,109,021 V508L probably benign Het
Mtus2 C T 5: 148,313,413 T155M probably damaging Het
Napepld A T 5: 21,683,289 V54E probably benign Het
Nlrc4 T C 17: 74,445,621 E589G probably benign Het
Nphp3 G T 9: 104,039,326 probably benign Het
Nr2f1 T A 13: 78,195,675 R10* probably null Het
Nsfl1c C A 2: 151,510,904 probably null Het
Olfr304 A G 7: 86,386,123 V179A possibly damaging Het
Pcdhgc3 A G 18: 37,808,528 T661A probably damaging Het
Pdzrn3 A G 6: 101,172,371 V332A possibly damaging Het
Pkhd1 C T 1: 20,200,927 C3134Y probably damaging Het
Ptprz1 T C 6: 23,036,895 V1131A probably damaging Het
Rccd1 T C 7: 80,320,368 E167G probably benign Het
Ror1 T C 4: 100,407,923 I198T possibly damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scly C T 1: 91,302,851 probably benign Het
Sh3rf2 T C 18: 42,153,319 S594P probably damaging Het
Slc19a1 G A 10: 77,041,975 V115M possibly damaging Het
Slc26a6 A T 9: 108,854,196 probably benign Het
Smg7 C T 1: 152,852,598 R439K probably null Het
Syne2 A G 12: 75,966,479 R2815G probably damaging Het
Tmem55a A G 4: 14,902,506 N169S probably damaging Het
Trim75 G A 8: 64,982,827 R324C probably damaging Het
Ucp3 T C 7: 100,480,251 S98P probably benign Het
Zscan29 G C 2: 121,160,731 R859G probably benign Het
Other mutations in Scn4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Scn4a APN 11 106319919 missense probably benign
IGL00846:Scn4a APN 11 106328118 missense probably benign 0.03
IGL01063:Scn4a APN 11 106330364 missense possibly damaging 0.91
IGL01450:Scn4a APN 11 106324661 missense probably damaging 0.99
IGL01922:Scn4a APN 11 106339152 critical splice donor site probably null
IGL02589:Scn4a APN 11 106328132 missense probably benign 0.08
IGL03171:Scn4a APN 11 106345592 missense probably benign 0.01
IGL03338:Scn4a APN 11 106320845 missense probably damaging 1.00
BB004:Scn4a UTSW 11 106342383 missense probably damaging 1.00
BB014:Scn4a UTSW 11 106342383 missense probably damaging 1.00
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0050:Scn4a UTSW 11 106320856 missense probably damaging 1.00
R0113:Scn4a UTSW 11 106345436 missense probably benign 0.00
R0193:Scn4a UTSW 11 106320538 nonsense probably null
R0410:Scn4a UTSW 11 106323949 missense probably damaging 1.00
R0512:Scn4a UTSW 11 106345677 missense probably damaging 1.00
R0532:Scn4a UTSW 11 106330400 missense probably benign 0.45
R1112:Scn4a UTSW 11 106320466 missense probably damaging 1.00
R1279:Scn4a UTSW 11 106335682 missense probably damaging 1.00
R1564:Scn4a UTSW 11 106345541 missense probably benign
R1712:Scn4a UTSW 11 106339354 missense probably damaging 1.00
R1712:Scn4a UTSW 11 106345547 missense probably benign 0.20
R1721:Scn4a UTSW 11 106320820 missense probably benign 0.31
R1900:Scn4a UTSW 11 106327533 missense probably damaging 1.00
R2057:Scn4a UTSW 11 106335724 missense probably damaging 0.97
R2209:Scn4a UTSW 11 106339225 missense probably damaging 1.00
R3416:Scn4a UTSW 11 106330413 missense probably benign 0.00
R3788:Scn4a UTSW 11 106344274 missense probably damaging 0.96
R3853:Scn4a UTSW 11 106320106 missense possibly damaging 0.94
R3912:Scn4a UTSW 11 106320716 missense probably damaging 1.00
R3983:Scn4a UTSW 11 106347818 missense probably damaging 1.00
R4036:Scn4a UTSW 11 106322057 missense possibly damaging 0.75
R4358:Scn4a UTSW 11 106348857 splice site probably null
R4556:Scn4a UTSW 11 106320446 missense probably benign 0.32
R4677:Scn4a UTSW 11 106323962 missense probably damaging 1.00
R4863:Scn4a UTSW 11 106320002 missense probably damaging 1.00
R4924:Scn4a UTSW 11 106320088 missense possibly damaging 0.83
R5081:Scn4a UTSW 11 106348727 missense probably damaging 0.99
R5298:Scn4a UTSW 11 106339386 missense probably damaging 1.00
R5407:Scn4a UTSW 11 106320889 missense probably damaging 1.00
R5634:Scn4a UTSW 11 106330004 missense probably benign
R6381:Scn4a UTSW 11 106320311 missense probably damaging 1.00
R6468:Scn4a UTSW 11 106345676 missense probably damaging 1.00
R6489:Scn4a UTSW 11 106349180 missense probably benign 0.26
R6549:Scn4a UTSW 11 106343965 missense probably damaging 1.00
R6606:Scn4a UTSW 11 106328073 missense probably benign 0.39
R7037:Scn4a UTSW 11 106320900 missense probably damaging 0.98
R7064:Scn4a UTSW 11 106322157 missense possibly damaging 0.93
R7182:Scn4a UTSW 11 106330308 missense probably benign 0.21
R7194:Scn4a UTSW 11 106324236 missense probably benign 0.32
R7531:Scn4a UTSW 11 106348697 splice site probably null
R7552:Scn4a UTSW 11 106349169 missense probably benign 0.22
R7570:Scn4a UTSW 11 106320473 missense possibly damaging 0.54
R7635:Scn4a UTSW 11 106324632 missense probably damaging 1.00
R7823:Scn4a UTSW 11 106342508 missense probably damaging 1.00
R7832:Scn4a UTSW 11 106322015 missense probably benign 0.01
R7927:Scn4a UTSW 11 106342383 missense probably damaging 1.00
R8122:Scn4a UTSW 11 106330331 missense probably benign 0.02
R8131:Scn4a UTSW 11 106341541 missense probably benign
X0012:Scn4a UTSW 11 106330061 missense probably damaging 1.00
X0065:Scn4a UTSW 11 106322178 missense probably damaging 0.98
Z1176:Scn4a UTSW 11 106321908 missense probably null 0.29
Z1176:Scn4a UTSW 11 106341529 missense probably benign 0.26
Z1176:Scn4a UTSW 11 106341530 missense probably damaging 0.97
Z1177:Scn4a UTSW 11 106330208 missense not run
Z1177:Scn4a UTSW 11 106341542 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACGTGCTCATGTTACAGGG -3'
(R):5'- TAGAAGAAAGCCAGGGACCCTC -3'

Sequencing Primer
(F):5'- CTCATGTTACAGGGCCCTATGG -3'
(R):5'- CCACCTCCTGAGCATGC -3'
Posted On2015-04-06