Incidental Mutation 'R3862:Gm597'
ID 276380
Institutional Source Beutler Lab
Gene Symbol Gm597
Ensembl Gene ENSMUSG00000048411
Gene Name predicted gene 597
Synonyms LOC210962
MMRRC Submission 040903-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R3862 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 28776117-28780252 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 28777641 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 437 (T437A)
Ref Sequence ENSEMBL: ENSMUSP00000058140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059937]
AlphaFold E9Q8J5
Predicted Effect probably damaging
Transcript: ENSMUST00000059937
AA Change: T437A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058140
Gene: ENSMUSG00000048411
AA Change: T437A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 112 129 N/A INTRINSIC
Pfam:FAM75 137 472 8.1e-14 PFAM
low complexity region 664 675 N/A INTRINSIC
internal_repeat_1 718 807 1.4e-5 PROSPERO
internal_repeat_1 807 894 1.4e-5 PROSPERO
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,885,398 F134I possibly damaging Het
Apc2 G A 10: 80,307,559 G498R possibly damaging Het
Bub1 A G 2: 127,814,756 probably benign Het
Cttnbp2 C T 6: 18,434,906 V318M probably benign Het
D430041D05Rik T C 2: 104,214,177 I825M possibly damaging Het
Enpp6 A G 8: 47,065,992 Q265R probably benign Het
Eri1 A G 8: 35,491,294 V61A possibly damaging Het
Evi2 T A 11: 79,515,646 I368F probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fkbp9 A G 6: 56,868,905 T409A probably benign Het
Gtpbp4 A G 13: 8,990,798 V97A probably damaging Het
Hapln1 C T 13: 89,605,299 Q195* probably null Het
Helt G T 8: 46,292,278 N189K probably benign Het
Hint2 A G 4: 43,654,771 V91A probably damaging Het
Ighv1-7 A G 12: 114,538,646 I67T probably damaging Het
Kif26a A G 12: 112,179,889 E1803G probably benign Het
Lrrd1 G A 5: 3,851,248 V518I probably benign Het
March11 C T 15: 26,387,866 A269V probably damaging Het
Mep1b A G 18: 21,084,169 N115S possibly damaging Het
Naif1 A G 2: 32,452,625 R63G probably damaging Het
Nsmaf A G 4: 6,435,064 I126T probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr652 G A 7: 104,564,938 R239H probably benign Het
Olfr968 T A 9: 39,772,624 M59L probably benign Het
Pcdhb3 A G 18: 37,303,276 E765G probably damaging Het
Ppp4r4 C T 12: 103,596,421 R550* probably null Het
Scgb2b3 C T 7: 31,362,005 probably null Het
Sgcz T C 8: 37,523,411 I263V probably benign Het
Slc15a1 C T 14: 121,484,857 V211I probably benign Het
Slc25a21 G T 12: 56,718,135 probably benign Het
Snrnp200 C A 2: 127,233,099 probably benign Het
Sptbn1 G T 11: 30,142,329 Q479K possibly damaging Het
Stag1 T A 9: 100,944,785 V935D probably benign Het
Veph1 C T 3: 66,254,892 C115Y probably damaging Het
Zc3h12a T C 4: 125,126,939 D37G probably benign Het
Zfand4 A T 6: 116,293,815 probably benign Het
Other mutations in Gm597
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Gm597 APN 1 28778651 missense possibly damaging 0.94
IGL00885:Gm597 APN 1 28776845 missense unknown
IGL01296:Gm597 APN 1 28777056 missense probably benign 0.23
IGL01476:Gm597 APN 1 28777453 missense probably benign 0.04
IGL02125:Gm597 APN 1 28776338 missense possibly damaging 0.91
IGL02410:Gm597 APN 1 28778631 missense probably benign 0.25
IGL02982:Gm597 APN 1 28778054 missense probably damaging 1.00
IGL03031:Gm597 APN 1 28778583 missense probably benign 0.03
IGL03267:Gm597 APN 1 28777121 missense probably damaging 1.00
R0294:Gm597 UTSW 1 28778663 missense probably benign 0.00
R0433:Gm597 UTSW 1 28777342 nonsense probably null
R0485:Gm597 UTSW 1 28778142 missense probably damaging 1.00
R0645:Gm597 UTSW 1 28776930 missense probably damaging 0.99
R0744:Gm597 UTSW 1 28777821 missense possibly damaging 0.46
R0836:Gm597 UTSW 1 28777821 missense possibly damaging 0.46
R1036:Gm597 UTSW 1 28777802 missense probably benign 0.01
R1302:Gm597 UTSW 1 28776340 missense probably benign 0.00
R1394:Gm597 UTSW 1 28776809 missense possibly damaging 0.61
R1395:Gm597 UTSW 1 28776809 missense possibly damaging 0.61
R1514:Gm597 UTSW 1 28778748 missense possibly damaging 0.83
R1535:Gm597 UTSW 1 28777424 missense probably damaging 1.00
R2004:Gm597 UTSW 1 28777179 missense probably damaging 1.00
R2021:Gm597 UTSW 1 28778153 missense probably damaging 0.98
R2022:Gm597 UTSW 1 28778153 missense probably damaging 0.98
R3115:Gm597 UTSW 1 28776329 missense possibly damaging 0.92
R3615:Gm597 UTSW 1 28776575 missense probably benign 0.26
R3616:Gm597 UTSW 1 28776575 missense probably benign 0.26
R4067:Gm597 UTSW 1 28777631 missense probably damaging 0.98
R4119:Gm597 UTSW 1 28777973 missense probably damaging 0.99
R4415:Gm597 UTSW 1 28777133 missense probably benign 0.01
R5010:Gm597 UTSW 1 28777862 missense possibly damaging 0.52
R5109:Gm597 UTSW 1 28777555 missense possibly damaging 0.46
R5122:Gm597 UTSW 1 28780060 missense probably benign 0.00
R5533:Gm597 UTSW 1 28778082 missense probably damaging 1.00
R6085:Gm597 UTSW 1 28778227 missense possibly damaging 0.55
R6116:Gm597 UTSW 1 28778699 missense probably benign 0.01
R6750:Gm597 UTSW 1 28777414 missense probably damaging 0.98
R6757:Gm597 UTSW 1 28780110 missense probably damaging 0.98
R6774:Gm597 UTSW 1 28776893 missense probably benign 0.00
R7156:Gm597 UTSW 1 28776767 missense possibly damaging 0.53
R7365:Gm597 UTSW 1 28780152 missense probably benign 0.04
R7739:Gm597 UTSW 1 28777608 missense possibly damaging 0.72
R7996:Gm597 UTSW 1 28778406 missense probably damaging 0.98
R8082:Gm597 UTSW 1 28777498 missense probably benign 0.08
R8281:Gm597 UTSW 1 28778144 missense possibly damaging 0.77
R8514:Gm597 UTSW 1 28778505 missense probably damaging 1.00
R8944:Gm597 UTSW 1 28777074 missense probably benign 0.00
R9042:Gm597 UTSW 1 28776956 missense possibly damaging 0.72
R9101:Gm597 UTSW 1 28776659 missense probably benign 0.04
R9106:Gm597 UTSW 1 28776894 missense probably benign 0.00
R9173:Gm597 UTSW 1 28777349 missense probably benign 0.22
R9596:Gm597 UTSW 1 28776607 missense probably benign 0.07
R9632:Gm597 UTSW 1 28778039 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TTTGGATCTCCTGAACCTCTGG -3'
(R):5'- AGGGATGCTCTTAAACAAGGCC -3'

Sequencing Primer
(F):5'- TGGATCTCCTGAACCTCTGGAAAAG -3'
(R):5'- GGCCAAAACAAAGTTTGGCAC -3'
Posted On 2015-04-06