Incidental Mutation 'R3862:Zc3h12a'
ID276389
Institutional Source Beutler Lab
Gene Symbol Zc3h12a
Ensembl Gene ENSMUSG00000042677
Gene Namezinc finger CCCH type containing 12A
SynonymsMcpip1
MMRRC Submission 040903-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.714) question?
Stock #R3862 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location125118423-125127840 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125126939 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 37 (D37G)
Ref Sequence ENSEMBL: ENSMUSP00000037172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036188]
Predicted Effect probably benign
Transcript: ENSMUST00000036188
AA Change: D37G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037172
Gene: ENSMUSG00000042677
AA Change: D37G

DomainStartEndE-ValueType
Pfam:RNase_Zc3h12a 134 290 3.2e-66 PFAM
low complexity region 354 368 N/A INTRINSIC
low complexity region 476 487 N/A INTRINSIC
low complexity region 494 508 N/A INTRINSIC
low complexity region 514 544 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131685
Meta Mutation Damage Score 0.1264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ZC3H12A is an MCP1 (CCL2; MIM 158105)-induced protein that acts as a transcriptional activator and causes cell death of cardiomyocytes, possibly via induction of genes associated with apoptosis.[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit splenomegaly, lymphadenopathy, hyperimmunoglobulinemia, increased auto-antibodies, and defective IL6 post-transcriptional regulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,885,398 F134I possibly damaging Het
Apc2 G A 10: 80,307,559 G498R possibly damaging Het
Bub1 A G 2: 127,814,756 probably benign Het
Cttnbp2 C T 6: 18,434,906 V318M probably benign Het
D430041D05Rik T C 2: 104,214,177 I825M possibly damaging Het
Enpp6 A G 8: 47,065,992 Q265R probably benign Het
Eri1 A G 8: 35,491,294 V61A possibly damaging Het
Evi2 T A 11: 79,515,646 I368F probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fkbp9 A G 6: 56,868,905 T409A probably benign Het
Gm597 T C 1: 28,777,641 T437A probably damaging Het
Gtpbp4 A G 13: 8,990,798 V97A probably damaging Het
Hapln1 C T 13: 89,605,299 Q195* probably null Het
Helt G T 8: 46,292,278 N189K probably benign Het
Hint2 A G 4: 43,654,771 V91A probably damaging Het
Ighv1-7 A G 12: 114,538,646 I67T probably damaging Het
Kif26a A G 12: 112,179,889 E1803G probably benign Het
Lrrd1 G A 5: 3,851,248 V518I probably benign Het
March11 C T 15: 26,387,866 A269V probably damaging Het
Mep1b A G 18: 21,084,169 N115S possibly damaging Het
Naif1 A G 2: 32,452,625 R63G probably damaging Het
Nsmaf A G 4: 6,435,064 I126T probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr652 G A 7: 104,564,938 R239H probably benign Het
Olfr968 T A 9: 39,772,624 M59L probably benign Het
Pcdhb3 A G 18: 37,303,276 E765G probably damaging Het
Ppp4r4 C T 12: 103,596,421 R550* probably null Het
Scgb2b3 C T 7: 31,362,005 probably null Het
Sgcz T C 8: 37,523,411 I263V probably benign Het
Slc15a1 C T 14: 121,484,857 V211I probably benign Het
Slc25a21 G T 12: 56,718,135 probably benign Het
Snrnp200 C A 2: 127,233,099 probably benign Het
Sptbn1 G T 11: 30,142,329 Q479K possibly damaging Het
Stag1 T A 9: 100,944,785 V935D probably benign Het
Veph1 C T 3: 66,254,892 C115Y probably damaging Het
Zfand4 A T 6: 116,293,815 probably benign Het
Other mutations in Zc3h12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01928:Zc3h12a APN 4 125119986 missense probably benign 0.00
IGL02419:Zc3h12a APN 4 125119788 missense probably benign
IGL03085:Zc3h12a APN 4 125127020 missense probably benign 0.19
IGL03181:Zc3h12a APN 4 125119304 missense probably damaging 1.00
I1329:Zc3h12a UTSW 4 125119364 missense possibly damaging 0.85
P0022:Zc3h12a UTSW 4 125119409 missense possibly damaging 0.69
R2084:Zc3h12a UTSW 4 125120009 missense probably benign 0.00
R2149:Zc3h12a UTSW 4 125126642 missense possibly damaging 0.77
R2404:Zc3h12a UTSW 4 125119523 missense probably damaging 1.00
R3891:Zc3h12a UTSW 4 125126885 missense probably damaging 1.00
R4707:Zc3h12a UTSW 4 125120893 missense probably damaging 1.00
R5215:Zc3h12a UTSW 4 125126913 missense probably benign 0.17
R5283:Zc3h12a UTSW 4 125126765 missense probably benign 0.11
R5570:Zc3h12a UTSW 4 125120373 missense probably damaging 1.00
X0026:Zc3h12a UTSW 4 125126871 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTAGCTGAGCCATGCTTC -3'
(R):5'- ATAGCGTCTTCTCAGTTCGTG -3'

Sequencing Primer
(F):5'- GAGCCATGCTTCACCAATTC -3'
(R):5'- AGAGACCTATATTGGGCATTGC -3'
Posted On2015-04-06