Incidental Mutation 'R3862:Scgb2b3'
ID276395
Institutional Source Beutler Lab
Gene Symbol Scgb2b3
Ensembl Gene ENSMUSG00000078754
Gene Namesecretoglobin, family 2B, member 3
Synonyms
MMRRC Submission 040903-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R3862 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location31359038-31362072 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 31362005 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108090]
Predicted Effect probably null
Transcript: ENSMUST00000108090
SMART Domains Protein: ENSMUSP00000103725
Gene: ENSMUSG00000078754

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Feld-I_B 25 91 4.6e-34 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,885,398 F134I possibly damaging Het
Apc2 G A 10: 80,307,559 G498R possibly damaging Het
Bub1 A G 2: 127,814,756 probably benign Het
Cttnbp2 C T 6: 18,434,906 V318M probably benign Het
D430041D05Rik T C 2: 104,214,177 I825M possibly damaging Het
Enpp6 A G 8: 47,065,992 Q265R probably benign Het
Eri1 A G 8: 35,491,294 V61A possibly damaging Het
Evi2 T A 11: 79,515,646 I368F probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fkbp9 A G 6: 56,868,905 T409A probably benign Het
Gm597 T C 1: 28,777,641 T437A probably damaging Het
Gtpbp4 A G 13: 8,990,798 V97A probably damaging Het
Hapln1 C T 13: 89,605,299 Q195* probably null Het
Helt G T 8: 46,292,278 N189K probably benign Het
Hint2 A G 4: 43,654,771 V91A probably damaging Het
Ighv1-7 A G 12: 114,538,646 I67T probably damaging Het
Kif26a A G 12: 112,179,889 E1803G probably benign Het
Lrrd1 G A 5: 3,851,248 V518I probably benign Het
March11 C T 15: 26,387,866 A269V probably damaging Het
Mep1b A G 18: 21,084,169 N115S possibly damaging Het
Naif1 A G 2: 32,452,625 R63G probably damaging Het
Nsmaf A G 4: 6,435,064 I126T probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr652 G A 7: 104,564,938 R239H probably benign Het
Olfr968 T A 9: 39,772,624 M59L probably benign Het
Pcdhb3 A G 18: 37,303,276 E765G probably damaging Het
Ppp4r4 C T 12: 103,596,421 R550* probably null Het
Sgcz T C 8: 37,523,411 I263V probably benign Het
Slc15a1 C T 14: 121,484,857 V211I probably benign Het
Slc25a21 G T 12: 56,718,135 probably benign Het
Snrnp200 C A 2: 127,233,099 probably benign Het
Sptbn1 G T 11: 30,142,329 Q479K possibly damaging Het
Stag1 T A 9: 100,944,785 V935D probably benign Het
Veph1 C T 3: 66,254,892 C115Y probably damaging Het
Zc3h12a T C 4: 125,126,939 D37G probably benign Het
Zfand4 A T 6: 116,293,815 probably benign Het
Other mutations in Scgb2b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1664:Scgb2b3 UTSW 7 31359039 makesense probably null
R1772:Scgb2b3 UTSW 7 31360196 missense possibly damaging 0.95
R5819:Scgb2b3 UTSW 7 31360214 missense possibly damaging 0.67
R6433:Scgb2b3 UTSW 7 31359067 missense probably benign 0.15
R7135:Scgb2b3 UTSW 7 31360214 missense possibly damaging 0.67
R7145:Scgb2b3 UTSW 7 31360148 missense probably benign 0.00
R7553:Scgb2b3 UTSW 7 31360248 missense possibly damaging 0.84
R7908:Scgb2b3 UTSW 7 31362014 missense probably damaging 0.98
R8172:Scgb2b3 UTSW 7 31359051 missense possibly damaging 0.78
R8350:Scgb2b3 UTSW 7 31362060 missense probably damaging 1.00
X0027:Scgb2b3 UTSW 7 31360256 missense probably benign 0.00
Z1186:Scgb2b3 UTSW 7 31359121 missense probably benign
Z1186:Scgb2b3 UTSW 7 31360167 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCACGAAAGCTGCACACTTG -3'
(R):5'- CCACAGATGCTAGATTCTTTGCC -3'

Sequencing Primer
(F):5'- TGCTTCAACTGAGCATCTATGG -3'
(R):5'- CAGATGCTAGATTCTTTGCCAAAAGG -3'
Posted On2015-04-06