Incidental Mutation 'R3862:Stag1'
ID276403
Institutional Source Beutler Lab
Gene Symbol Stag1
Ensembl Gene ENSMUSG00000037286
Gene Namestromal antigen 1
SynonymsScc3, SA-1
MMRRC Submission 040903-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3862 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location100597798-100959375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100944785 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 935 (V935D)
Ref Sequence ENSEMBL: ENSMUSP00000040724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041418] [ENSMUST00000123302] [ENSMUST00000129269] [ENSMUST00000155108]
Predicted Effect probably benign
Transcript: ENSMUST00000041418
AA Change: V935D

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000040724
Gene: ENSMUSG00000037286
AA Change: V935D

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:STAG 157 276 1.5e-50 PFAM
SCOP:d1qbkb_ 279 850 4e-5 SMART
low complexity region 1062 1081 N/A INTRINSIC
low complexity region 1107 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123302
SMART Domains Protein: ENSMUSP00000117879
Gene: ENSMUSG00000037286

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:STAG 157 276 2.9e-51 PFAM
low complexity region 303 315 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129269
AA Change: V935D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000116205
Gene: ENSMUSG00000037286
AA Change: V935D

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:STAG 160 274 3.8e-41 PFAM
SCOP:d1qbkb_ 279 850 3e-5 SMART
low complexity region 1062 1081 N/A INTRINSIC
low complexity region 1107 1120 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000143955
AA Change: V104D
SMART Domains Protein: ENSMUSP00000115460
Gene: ENSMUSG00000037286
AA Change: V104D

DomainStartEndE-ValueType
low complexity region 232 251 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000146934
AA Change: V545D
SMART Domains Protein: ENSMUSP00000120974
Gene: ENSMUSG00000037286
AA Change: V545D

DomainStartEndE-ValueType
low complexity region 673 692 N/A INTRINSIC
low complexity region 718 731 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149771
Predicted Effect probably benign
Transcript: ENSMUST00000155108
SMART Domains Protein: ENSMUSP00000118952
Gene: ENSMUSG00000037286

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Meta Mutation Damage Score 0.0626 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the SCC3 family and is expressed in the nucleus. It encodes a component of cohesin, a multisubunit protein complex that provides sister chromatid cohesion along the length of a chromosome from DNA replication through prophase and prometaphase, after which it is dissociated in preparation for segregation during anaphase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mouse embryos homozygous for a null mutation show developmental delay and die before birth. Heterozygous animals have shorter lifespan and earlier onset of tumourigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,885,398 F134I possibly damaging Het
Apc2 G A 10: 80,307,559 G498R possibly damaging Het
Bub1 A G 2: 127,814,756 probably benign Het
Cttnbp2 C T 6: 18,434,906 V318M probably benign Het
D430041D05Rik T C 2: 104,214,177 I825M possibly damaging Het
Enpp6 A G 8: 47,065,992 Q265R probably benign Het
Eri1 A G 8: 35,491,294 V61A possibly damaging Het
Evi2 T A 11: 79,515,646 I368F probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fkbp9 A G 6: 56,868,905 T409A probably benign Het
Gm597 T C 1: 28,777,641 T437A probably damaging Het
Gtpbp4 A G 13: 8,990,798 V97A probably damaging Het
Hapln1 C T 13: 89,605,299 Q195* probably null Het
Helt G T 8: 46,292,278 N189K probably benign Het
Hint2 A G 4: 43,654,771 V91A probably damaging Het
Ighv1-7 A G 12: 114,538,646 I67T probably damaging Het
Kif26a A G 12: 112,179,889 E1803G probably benign Het
Lrrd1 G A 5: 3,851,248 V518I probably benign Het
March11 C T 15: 26,387,866 A269V probably damaging Het
Mep1b A G 18: 21,084,169 N115S possibly damaging Het
Naif1 A G 2: 32,452,625 R63G probably damaging Het
Nsmaf A G 4: 6,435,064 I126T probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr652 G A 7: 104,564,938 R239H probably benign Het
Olfr968 T A 9: 39,772,624 M59L probably benign Het
Pcdhb3 A G 18: 37,303,276 E765G probably damaging Het
Ppp4r4 C T 12: 103,596,421 R550* probably null Het
Scgb2b3 C T 7: 31,362,005 probably null Het
Sgcz T C 8: 37,523,411 I263V probably benign Het
Slc15a1 C T 14: 121,484,857 V211I probably benign Het
Slc25a21 G T 12: 56,718,135 probably benign Het
Snrnp200 C A 2: 127,233,099 probably benign Het
Sptbn1 G T 11: 30,142,329 Q479K possibly damaging Het
Veph1 C T 3: 66,254,892 C115Y probably damaging Het
Zc3h12a T C 4: 125,126,939 D37G probably benign Het
Zfand4 A T 6: 116,293,815 probably benign Het
Other mutations in Stag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00649:Stag1 APN 9 100776808 missense probably damaging 1.00
IGL01010:Stag1 APN 9 100945933 missense probably benign 0.06
IGL01012:Stag1 APN 9 100855859 missense possibly damaging 0.47
IGL01025:Stag1 APN 9 100951657 missense possibly damaging 0.95
IGL01307:Stag1 APN 9 100951788 intron probably benign
IGL02149:Stag1 APN 9 100887389 missense probably benign 0.09
IGL02608:Stag1 APN 9 100757769 missense probably null 0.99
IGL03008:Stag1 APN 9 100776791 missense probably damaging 1.00
IGL03210:Stag1 APN 9 100845076 missense possibly damaging 0.63
eto_o UTSW 9 100796716 missense probably damaging 1.00
PIT4280001:Stag1 UTSW 9 100942716 missense possibly damaging 0.95
R0070:Stag1 UTSW 9 100956408 missense probably null 1.00
R0070:Stag1 UTSW 9 100956408 missense probably null 1.00
R0349:Stag1 UTSW 9 100776784 missense probably damaging 0.98
R0479:Stag1 UTSW 9 100928091 missense probably benign 0.00
R0531:Stag1 UTSW 9 100954247 makesense probably null
R0962:Stag1 UTSW 9 100796827 missense probably damaging 1.00
R0976:Stag1 UTSW 9 100776824 missense probably damaging 0.98
R0976:Stag1 UTSW 9 100930016 critical splice donor site probably null
R1170:Stag1 UTSW 9 100888453 intron probably benign
R1499:Stag1 UTSW 9 100855832 missense possibly damaging 0.77
R1499:Stag1 UTSW 9 100887373 intron probably benign
R1644:Stag1 UTSW 9 100880900 intron probably benign
R1747:Stag1 UTSW 9 100888300 missense probably benign
R1799:Stag1 UTSW 9 100953462 intron probably null
R1807:Stag1 UTSW 9 100908666 missense probably benign 0.34
R1978:Stag1 UTSW 9 100888086 missense probably benign 0.03
R2029:Stag1 UTSW 9 100786687 missense probably damaging 1.00
R2161:Stag1 UTSW 9 100889595 missense probably damaging 1.00
R2300:Stag1 UTSW 9 100712500 missense possibly damaging 0.92
R2327:Stag1 UTSW 9 100786613 missense possibly damaging 0.81
R2426:Stag1 UTSW 9 100845116 critical splice donor site probably null
R2448:Stag1 UTSW 9 100888409 missense probably benign 0.42
R2504:Stag1 UTSW 9 100866210 missense probably damaging 0.99
R3713:Stag1 UTSW 9 100889618 missense probably benign 0.01
R3835:Stag1 UTSW 9 100737982 missense probably damaging 0.97
R4398:Stag1 UTSW 9 100956606 utr 3 prime probably benign
R4568:Stag1 UTSW 9 100848669 missense probably damaging 1.00
R4651:Stag1 UTSW 9 100796716 missense probably damaging 1.00
R4652:Stag1 UTSW 9 100796716 missense probably damaging 1.00
R4653:Stag1 UTSW 9 100796716 missense probably damaging 1.00
R4675:Stag1 UTSW 9 100848705 missense probably damaging 1.00
R4709:Stag1 UTSW 9 100738039 missense probably damaging 0.99
R4924:Stag1 UTSW 9 100796755 missense possibly damaging 0.67
R5018:Stag1 UTSW 9 100951619 missense probably benign 0.00
R5435:Stag1 UTSW 9 100953550 missense probably benign 0.03
R5460:Stag1 UTSW 9 100956453 splice site probably null
R5805:Stag1 UTSW 9 100796778 missense probably damaging 1.00
R6127:Stag1 UTSW 9 100951697 missense probably benign 0.05
R6313:Stag1 UTSW 9 100757733 missense probably damaging 1.00
R6597:Stag1 UTSW 9 100887420 missense probably benign 0.01
R6807:Stag1 UTSW 9 100944850 missense probably damaging 1.00
R7099:Stag1 UTSW 9 100944826 missense probably benign 0.02
R7167:Stag1 UTSW 9 100945889 missense probably benign 0.05
R7395:Stag1 UTSW 9 100796728 missense probably damaging 0.99
R7504:Stag1 UTSW 9 100888328 missense probably benign 0.09
R7663:Stag1 UTSW 9 100738138 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGCTTGTGCTACATTTCTGTC -3'
(R):5'- ACTCACAGGTGGTTTAAGAAAGC -3'

Sequencing Primer
(F):5'- CTCCATTTTCAAATATGTGTGTGTG -3'
(R):5'- CACAGGTGGTTTAAGAAAGCCTTTTC -3'
Posted On2015-04-06