Incidental Mutation 'R3862:Evi2'
ID276407
Institutional Source Beutler Lab
Gene Symbol Evi2
Ensembl Gene ENSMUSG00000070354
Gene Nameecotropic viral integration site 2
SynonymsGm21975
MMRRC Submission 040903-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R3862 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location79513385-79530589 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79515646 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 368 (I368F)
Ref Sequence ENSEMBL: ENSMUSP00000136153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000093983] [ENSMUST00000108251] [ENSMUST00000170422] [ENSMUST00000179322]
Predicted Effect probably benign
Transcript: ENSMUST00000071325
SMART Domains Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716

DomainStartEndE-ValueType
RasGAP 1189 1559 2.56e-151 SMART
SEC14 1585 1737 2.36e-11 SMART
low complexity region 2619 2629 N/A INTRINSIC
low complexity region 2750 2763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093983
SMART Domains Protein: ENSMUSP00000091519
Gene: ENSMUSG00000070354

DomainStartEndE-ValueType
Pfam:EVI2A 1 75 1.2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108251
SMART Domains Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716

DomainStartEndE-ValueType
RasGAP 1189 1538 1.23e-153 SMART
SEC14 1564 1716 2.36e-11 SMART
low complexity region 2598 2608 N/A INTRINSIC
low complexity region 2729 2742 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170422
AA Change: I368F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000128569
Gene: ENSMUSG00000070354
AA Change: I368F

DomainStartEndE-ValueType
low complexity region 139 152 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
low complexity region 334 348 N/A INTRINSIC
low complexity region 391 396 N/A INTRINSIC
low complexity region 425 444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179322
AA Change: I368F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000136153
Gene: ENSMUSG00000093938
AA Change: I368F

DomainStartEndE-ValueType
low complexity region 139 152 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
low complexity region 334 348 N/A INTRINSIC
low complexity region 391 396 N/A INTRINSIC
low complexity region 425 444 N/A INTRINSIC
Meta Mutation Damage Score 0.1524 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: This locus represents naturally occurring readthrough transcription between the neighboring Evi2a (ecotropic viral integration site 2a) and Evi2b (ecotropic viral integration site 2b) genes on chromosome 11. The readthrough transcript encodes a protein identical to that of the downstream gene product. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,885,398 F134I possibly damaging Het
Apc2 G A 10: 80,307,559 G498R possibly damaging Het
Bub1 A G 2: 127,814,756 probably benign Het
Cttnbp2 C T 6: 18,434,906 V318M probably benign Het
D430041D05Rik T C 2: 104,214,177 I825M possibly damaging Het
Enpp6 A G 8: 47,065,992 Q265R probably benign Het
Eri1 A G 8: 35,491,294 V61A possibly damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fkbp9 A G 6: 56,868,905 T409A probably benign Het
Gm597 T C 1: 28,777,641 T437A probably damaging Het
Gtpbp4 A G 13: 8,990,798 V97A probably damaging Het
Hapln1 C T 13: 89,605,299 Q195* probably null Het
Helt G T 8: 46,292,278 N189K probably benign Het
Hint2 A G 4: 43,654,771 V91A probably damaging Het
Ighv1-7 A G 12: 114,538,646 I67T probably damaging Het
Kif26a A G 12: 112,179,889 E1803G probably benign Het
Lrrd1 G A 5: 3,851,248 V518I probably benign Het
March11 C T 15: 26,387,866 A269V probably damaging Het
Mep1b A G 18: 21,084,169 N115S possibly damaging Het
Naif1 A G 2: 32,452,625 R63G probably damaging Het
Nsmaf A G 4: 6,435,064 I126T probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr652 G A 7: 104,564,938 R239H probably benign Het
Olfr968 T A 9: 39,772,624 M59L probably benign Het
Pcdhb3 A G 18: 37,303,276 E765G probably damaging Het
Ppp4r4 C T 12: 103,596,421 R550* probably null Het
Scgb2b3 C T 7: 31,362,005 probably null Het
Sgcz T C 8: 37,523,411 I263V probably benign Het
Slc15a1 C T 14: 121,484,857 V211I probably benign Het
Slc25a21 G T 12: 56,718,135 probably benign Het
Snrnp200 C A 2: 127,233,099 probably benign Het
Sptbn1 G T 11: 30,142,329 Q479K possibly damaging Het
Stag1 T A 9: 100,944,785 V935D probably benign Het
Veph1 C T 3: 66,254,892 C115Y probably damaging Het
Zc3h12a T C 4: 125,126,939 D37G probably benign Het
Zfand4 A T 6: 116,293,815 probably benign Het
Other mutations in Evi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1540:Evi2 UTSW 11 79515586 missense probably benign 0.05
R1570:Evi2 UTSW 11 79516250 missense possibly damaging 0.55
R3863:Evi2 UTSW 11 79515646 missense probably benign 0.01
R3864:Evi2 UTSW 11 79515646 missense probably benign 0.01
R4427:Evi2 UTSW 11 79516356 missense possibly damaging 0.73
R4796:Evi2 UTSW 11 79515447 intron probably benign
R6342:Evi2 UTSW 11 79515958 missense probably benign 0.01
R7391:Evi2 UTSW 11 79515667 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGAACTCCTGGCATTGAGC -3'
(R):5'- GCACACTGCTAGCAGATGATTTAG -3'

Sequencing Primer
(F):5'- GCATTGAGCCTCGTGGG -3'
(R):5'- GCAACCTCAAGACTGATAATGTAG -3'
Posted On2015-04-06