Mutagenetix > Incidental Mutation

Incidental Mutation 'R3863:Sorcs2'

276423

Institutional Source

Beutler Lab

Gene Symbol

Sorcs2

Ensembl Gene

ENSMUSG00000029093

Gene Name

sortilin-related VPS10 domain containing receptor 2

Synonyms

VPS10 domain receptor protein

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3863 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

36174524-36555483 bp(-) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 36555007 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 128 (S128*)

Ref Sequence

ENSEMBL: ENSMUSP00000065292 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037370] [ENSMUST00000070720]

AlphaFold

Q9EPR5

Predicted Effect

probably null
Transcript: ENSMUST00000037370
AA Change: S128*

SMART Domains

Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093
AA Change: S128*

Domain	Start	End	E-Value	Type
signal peptide	1	51	N/A	INTRINSIC
low complexity region	54	64	N/A	INTRINSIC
low complexity region	89	103	N/A	INTRINSIC
low complexity region	106	130	N/A	INTRINSIC
VPS10	170	780	N/A	SMART
PKD	782	872	7.27e-2	SMART
transmembrane domain	1078	1100	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000070720
AA Change: S128*

SMART Domains

Protein: ENSMUSP00000065292
Gene: ENSMUSG00000029093
AA Change: S128*

Domain	Start	End	E-Value	Type
signal peptide	1	51	N/A	INTRINSIC
low complexity region	54	64	N/A	INTRINSIC
low complexity region	89	103	N/A	INTRINSIC
low complexity region	106	130	N/A	INTRINSIC
Blast:VPS10	170	213	2e-22	BLAST
low complexity region	214	227	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137040

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced dopamine levels and dopamine metabolism, dopaminergic hyperinnervation of the frontal cortex, hyperactivity, abnormal behavioral response to amphetamine, and decreased induction of Schwann cell apoptosis following sciatic nerve injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh18a1	A	T	19: 40,539,758 (GRCm39)	I739N	probably damaging	Het
Arfgef1	CAGAG	CAG	1: 10,212,811 (GRCm39)		probably null	Het
Ccdc85a	T	A	11: 28,527,335 (GRCm39)		probably null	Het
D430041D05Rik	T	C	2: 104,044,522 (GRCm39)	I825M	possibly damaging	Het
Evi2	T	A	11: 79,406,472 (GRCm39)	I368F	probably benign	Het
Greb1	G	A	12: 16,752,421 (GRCm39)	R974W	probably damaging	Het
Ighv1-7	A	G	12: 114,502,266 (GRCm39)	I67T	probably damaging	Het
Kcnd2	C	G	6: 21,217,262 (GRCm39)	S322*	probably null	Het
Lats1	T	C	10: 7,581,510 (GRCm39)	V765A	probably damaging	Het
Lrrd1	G	A	5: 3,901,248 (GRCm39)	V518I	probably benign	Het
Ltbp3	G	A	19: 5,804,050 (GRCm39)	R854Q	probably benign	Het
Marchf11	C	T	15: 26,387,952 (GRCm39)	A269V	probably damaging	Het
Mep1b	A	G	18: 21,217,226 (GRCm39)	N115S	possibly damaging	Het
N4bp1	T	C	8: 87,587,055 (GRCm39)	T628A	probably benign	Het
Nuak1	C	T	10: 84,213,951 (GRCm39)		probably null	Het
Obscn	T	C	11: 59,022,472 (GRCm39)	R758G	possibly damaging	Het
Parp8	A	G	13: 117,031,303 (GRCm39)	S470P	probably benign	Het
Pcdhb3	A	G	18: 37,436,329 (GRCm39)	E765G	probably damaging	Het
Rbm26	G	T	14: 105,358,504 (GRCm39)	Q912K	probably damaging	Het
Sgcz	T	C	8: 37,990,565 (GRCm39)	I263V	probably benign	Het
Slc15a1	C	T	14: 121,722,269 (GRCm39)	V211I	probably benign	Het
Slc4a4	T	C	5: 89,283,507 (GRCm39)	F442S	possibly damaging	Het
Vmn1r173	T	A	7: 23,401,977 (GRCm39)	F71I	probably damaging	Het

Other mutations in Sorcs2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Sorcs2	APN	5	36,194,745 (GRCm39)	splice site	probably null
IGL01064:Sorcs2	APN	5	36,222,696 (GRCm39)	missense	probably damaging	1.00
IGL01120:Sorcs2	APN	5	36,178,596 (GRCm39)	missense	probably damaging	0.99
IGL01730:Sorcs2	APN	5	36,205,153 (GRCm39)	missense	probably damaging	1.00
IGL02542:Sorcs2	APN	5	36,183,286 (GRCm39)	missense	probably damaging	0.98
IGL02730:Sorcs2	APN	5	36,219,896 (GRCm39)	missense	probably benign	0.11
IGL02965:Sorcs2	APN	5	36,235,301 (GRCm39)	missense	probably benign	0.13
IGL02997:Sorcs2	APN	5	36,225,492 (GRCm39)	missense	probably damaging	1.00
IGL03000:Sorcs2	APN	5	36,222,675 (GRCm39)	unclassified	probably benign
IGL03141:Sorcs2	APN	5	36,222,699 (GRCm39)	missense	probably benign	0.01
IGL03184:Sorcs2	APN	5	36,188,556 (GRCm39)	missense	probably benign	0.01
IGL03412:Sorcs2	APN	5	36,203,848 (GRCm39)	missense	probably damaging	1.00
R0180:Sorcs2	UTSW	5	36,311,189 (GRCm39)	missense	probably damaging	1.00
R0244:Sorcs2	UTSW	5	36,554,897 (GRCm39)	splice site	probably benign
R0345:Sorcs2	UTSW	5	36,185,218 (GRCm39)	missense	probably benign	0.01
R0519:Sorcs2	UTSW	5	36,188,534 (GRCm39)	missense	probably benign	0.08
R0624:Sorcs2	UTSW	5	36,222,777 (GRCm39)	missense	probably damaging	0.97
R0625:Sorcs2	UTSW	5	36,181,916 (GRCm39)	missense	possibly damaging	0.65
R1169:Sorcs2	UTSW	5	36,185,269 (GRCm39)	missense	possibly damaging	0.70
R1721:Sorcs2	UTSW	5	36,184,092 (GRCm39)	missense	probably damaging	0.98
R1809:Sorcs2	UTSW	5	36,386,564 (GRCm39)	splice site	probably benign
R1935:Sorcs2	UTSW	5	36,228,731 (GRCm39)	missense	possibly damaging	0.88
R1936:Sorcs2	UTSW	5	36,228,731 (GRCm39)	missense	possibly damaging	0.88
R2279:Sorcs2	UTSW	5	36,199,430 (GRCm39)	splice site	probably null
R3148:Sorcs2	UTSW	5	36,193,132 (GRCm39)	missense	probably benign	0.09
R3803:Sorcs2	UTSW	5	36,555,150 (GRCm39)	missense	probably benign	0.36
R4092:Sorcs2	UTSW	5	36,183,166 (GRCm39)	missense	possibly damaging	0.92
R4620:Sorcs2	UTSW	5	36,194,838 (GRCm39)	missense	probably benign	0.00
R5079:Sorcs2	UTSW	5	36,200,796 (GRCm39)	missense	probably damaging	1.00
R5301:Sorcs2	UTSW	5	36,196,734 (GRCm39)	missense	probably damaging	1.00
R5470:Sorcs2	UTSW	5	36,188,527 (GRCm39)	missense	probably benign	0.00
R5568:Sorcs2	UTSW	5	36,203,874 (GRCm39)	nonsense	probably null
R5727:Sorcs2	UTSW	5	36,188,630 (GRCm39)	missense	possibly damaging	0.52
R5874:Sorcs2	UTSW	5	36,386,555 (GRCm39)	missense	probably damaging	1.00
R5890:Sorcs2	UTSW	5	36,386,535 (GRCm39)	missense	probably damaging	1.00
R5946:Sorcs2	UTSW	5	36,186,427 (GRCm39)	missense	probably damaging	1.00
R6005:Sorcs2	UTSW	5	36,176,728 (GRCm39)	missense	probably damaging	1.00
R6048:Sorcs2	UTSW	5	36,185,332 (GRCm39)	splice site	probably null
R6290:Sorcs2	UTSW	5	36,219,931 (GRCm39)	missense	probably damaging	1.00
R6292:Sorcs2	UTSW	5	36,219,931 (GRCm39)	missense	probably damaging	1.00
R6617:Sorcs2	UTSW	5	36,235,310 (GRCm39)	missense	probably damaging	1.00
R6681:Sorcs2	UTSW	5	36,555,154 (GRCm39)	missense	probably benign	0.00
R7024:Sorcs2	UTSW	5	36,178,605 (GRCm39)	missense	probably damaging	0.99
R7056:Sorcs2	UTSW	5	36,225,474 (GRCm39)	missense	probably damaging	1.00
R7569:Sorcs2	UTSW	5	36,183,220 (GRCm39)	missense	probably benign	0.01
R7641:Sorcs2	UTSW	5	36,555,296 (GRCm39)	missense	probably damaging	0.99
R7651:Sorcs2	UTSW	5	36,185,322 (GRCm39)	missense	probably damaging	1.00
R7674:Sorcs2	UTSW	5	36,555,296 (GRCm39)	missense	probably damaging	0.99
R7722:Sorcs2	UTSW	5	36,200,871 (GRCm39)	missense	probably damaging	1.00
R7748:Sorcs2	UTSW	5	36,386,519 (GRCm39)	missense	possibly damaging	0.56
R7764:Sorcs2	UTSW	5	36,181,416 (GRCm39)	missense	possibly damaging	0.48
R7813:Sorcs2	UTSW	5	36,181,958 (GRCm39)	missense	probably damaging	1.00
R8142:Sorcs2	UTSW	5	36,219,958 (GRCm39)	missense	possibly damaging	0.67
R8246:Sorcs2	UTSW	5	36,219,932 (GRCm39)	missense	probably damaging	1.00
R8254:Sorcs2	UTSW	5	36,195,550 (GRCm39)	missense	probably benign	0.00
R8349:Sorcs2	UTSW	5	36,386,519 (GRCm39)	missense	possibly damaging	0.56
R8350:Sorcs2	UTSW	5	36,311,207 (GRCm39)	missense	probably damaging	0.96
R8354:Sorcs2	UTSW	5	36,222,753 (GRCm39)	missense	probably benign	0.01
R8449:Sorcs2	UTSW	5	36,386,519 (GRCm39)	missense	possibly damaging	0.56
R8679:Sorcs2	UTSW	5	36,196,657 (GRCm39)	missense	probably benign	0.09
R8771:Sorcs2	UTSW	5	36,188,624 (GRCm39)	missense	probably damaging	1.00
R8935:Sorcs2	UTSW	5	36,193,202 (GRCm39)	missense	possibly damaging	0.79
R8964:Sorcs2	UTSW	5	36,386,511 (GRCm39)	missense	possibly damaging	0.85
R9164:Sorcs2	UTSW	5	36,235,312 (GRCm39)	missense	possibly damaging	0.94
R9221:Sorcs2	UTSW	5	36,181,910 (GRCm39)	critical splice donor site	probably null
R9290:Sorcs2	UTSW	5	36,183,225 (GRCm39)	missense	probably damaging	0.96
R9358:Sorcs2	UTSW	5	36,200,814 (GRCm39)	missense	probably damaging	1.00
R9492:Sorcs2	UTSW	5	36,186,484 (GRCm39)	missense	probably benign	0.08
R9493:Sorcs2	UTSW	5	36,199,529 (GRCm39)	missense	possibly damaging	0.61
R9640:Sorcs2	UTSW	5	36,222,765 (GRCm39)	nonsense	probably null
RF063:Sorcs2	UTSW	5	36,311,155 (GRCm39)	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AGTAGCCAAGAATGCCCAGC -3'
(R):5'- TGTGCAGATCACTAGGCTGC -3'

Sequencing Primer
(F):5'- GAATGCCCAGCAGAGTGACC -3'
(R):5'- ATCCACAGGCACGAGAAT -3'

Posted On

2015-04-06