Incidental Mutation 'R3863:Nuak1'
ID276432
Institutional Source Beutler Lab
Gene Symbol Nuak1
Ensembl Gene ENSMUSG00000020032
Gene NameNUAK family, SNF1-like kinase, 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3863 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location84370905-84440597 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 84378087 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000020220]
Predicted Effect probably null
Transcript: ENSMUST00000020220
SMART Domains Protein: ENSMUSP00000020220
Gene: ENSMUSG00000020032

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
S_TKc 56 307 2.3e-105 SMART
low complexity region 475 490 N/A INTRINSIC
low complexity region 559 589 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000129355
SMART Domains Protein: ENSMUSP00000122927
Gene: ENSMUSG00000020032

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 15 156 3.1e-19 PFAM
Pfam:Pkinase 19 158 3.5e-38 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted disruption of this gene die perinatally displaying omphalocele with a failure in closure of the secondary body wall. No gross morphological defects are detected in brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh18a1 A T 19: 40,551,314 I739N probably damaging Het
Arfgef1 CAGAG CAG 1: 10,142,586 probably null Het
Ccdc85a T A 11: 28,577,335 probably null Het
D430041D05Rik T C 2: 104,214,177 I825M possibly damaging Het
Evi2 T A 11: 79,515,646 I368F probably benign Het
Greb1 G A 12: 16,702,420 R974W probably damaging Het
Ighv1-7 A G 12: 114,538,646 I67T probably damaging Het
Kcnd2 C G 6: 21,217,263 S322* probably null Het
Lats1 T C 10: 7,705,746 V765A probably damaging Het
Lrrd1 G A 5: 3,851,248 V518I probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
March11 C T 15: 26,387,866 A269V probably damaging Het
Mep1b A G 18: 21,084,169 N115S possibly damaging Het
N4bp1 T C 8: 86,860,427 T628A probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Parp8 A G 13: 116,894,767 S470P probably benign Het
Pcdhb3 A G 18: 37,303,276 E765G probably damaging Het
Rbm26 G T 14: 105,121,068 Q912K probably damaging Het
Sgcz T C 8: 37,523,411 I263V probably benign Het
Slc15a1 C T 14: 121,484,857 V211I probably benign Het
Slc4a4 T C 5: 89,135,648 F442S possibly damaging Het
Sorcs2 G T 5: 36,397,663 S128* probably null Het
Vmn1r173 T A 7: 23,702,552 F71I probably damaging Het
Other mutations in Nuak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Nuak1 APN 10 84375134 missense probably damaging 1.00
IGL01374:Nuak1 APN 10 84374668 missense probably damaging 0.96
IGL02967:Nuak1 APN 10 84440221 missense probably damaging 1.00
IGL03207:Nuak1 APN 10 84440129 missense possibly damaging 0.84
R0002:Nuak1 UTSW 10 84375367 missense probably damaging 1.00
R0277:Nuak1 UTSW 10 84374451 missense probably benign 0.02
R0749:Nuak1 UTSW 10 84374784 missense probably damaging 1.00
R0906:Nuak1 UTSW 10 84375280 missense probably damaging 1.00
R1227:Nuak1 UTSW 10 84440309 missense probably benign
R1367:Nuak1 UTSW 10 84392328 splice site probably benign
R1778:Nuak1 UTSW 10 84374874 unclassified probably null
R2151:Nuak1 UTSW 10 84409645 missense probably benign 0.00
R2877:Nuak1 UTSW 10 84375345 missense possibly damaging 0.79
R4386:Nuak1 UTSW 10 84394044 missense probably damaging 1.00
R4849:Nuak1 UTSW 10 84375279 missense probably damaging 1.00
R4962:Nuak1 UTSW 10 84375115 missense probably damaging 1.00
R5118:Nuak1 UTSW 10 84374984 missense probably benign 0.04
R5134:Nuak1 UTSW 10 84374350 missense probably benign 0.01
R5248:Nuak1 UTSW 10 84409678 missense probably damaging 1.00
R5590:Nuak1 UTSW 10 84375255 missense probably benign
R5719:Nuak1 UTSW 10 84409720 missense probably damaging 1.00
R5933:Nuak1 UTSW 10 84374802 missense probably damaging 0.99
R7067:Nuak1 UTSW 10 84440294 missense possibly damaging 0.59
R7169:Nuak1 UTSW 10 84374745 missense probably damaging 1.00
R7342:Nuak1 UTSW 10 84374967 missense probably damaging 1.00
R7549:Nuak1 UTSW 10 84374539 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CGGCTTGCCACGTTTTATAC -3'
(R):5'- TGGGGTCCGTATACTATCTCC -3'

Sequencing Primer
(F):5'- GGCTTGCCACGTTTTATACAGAATAG -3'
(R):5'- GGGTCCGTATACTATCTCCTATGTG -3'
Posted On2015-04-06