Incidental Mutation 'R3863:Rbm26'
ID276439
Institutional Source Beutler Lab
Gene Symbol Rbm26
Ensembl Gene ENSMUSG00000022119
Gene NameRNA binding motif protein 26
Synonyms1700009P03Rik, Pro1777, C230097K14Rik
Accession Numbers

Genbank: NM_134077; MGI: 1921463

Is this an essential gene? Possibly essential (E-score: 0.617) question?
Stock #R3863 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location105106751-105177327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 105121068 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 912 (Q912K)
Ref Sequence ENSEMBL: ENSMUSP00000022715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022715] [ENSMUST00000100327] [ENSMUST00000163499] [ENSMUST00000163545] [ENSMUST00000172122]
Predicted Effect probably damaging
Transcript: ENSMUST00000022715
AA Change: Q912K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022715
Gene: ENSMUSG00000022119
AA Change: Q912K

DomainStartEndE-ValueType
Pfam:PWI 10 80 1.1e-9 PFAM
low complexity region 102 123 N/A INTRINSIC
low complexity region 131 186 N/A INTRINSIC
low complexity region 190 215 N/A INTRINSIC
ZnF_C3H1 289 315 2.61e-4 SMART
low complexity region 330 389 N/A INTRINSIC
low complexity region 394 409 N/A INTRINSIC
RRM 533 602 7.74e-3 SMART
low complexity region 722 735 N/A INTRINSIC
Blast:RRM_2 753 820 6e-19 BLAST
low complexity region 848 879 N/A INTRINSIC
RRM 892 956 2.1e-1 SMART
low complexity region 970 1002 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100327
AA Change: Q888K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097901
Gene: ENSMUSG00000022119
AA Change: Q888K

DomainStartEndE-ValueType
Pfam:PWI 10 80 6.1e-10 PFAM
low complexity region 102 123 N/A INTRINSIC
low complexity region 131 186 N/A INTRINSIC
low complexity region 190 215 N/A INTRINSIC
ZnF_C3H1 289 315 2.61e-4 SMART
low complexity region 330 389 N/A INTRINSIC
low complexity region 394 409 N/A INTRINSIC
RRM 533 602 7.74e-3 SMART
low complexity region 698 711 N/A INTRINSIC
Blast:RRM_2 729 796 6e-19 BLAST
low complexity region 824 855 N/A INTRINSIC
RRM 868 932 2.1e-1 SMART
low complexity region 946 978 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163499
AA Change: Q917K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128197
Gene: ENSMUSG00000022119
AA Change: Q917K

DomainStartEndE-ValueType
Pfam:PWI 10 80 6.2e-10 PFAM
low complexity region 102 123 N/A INTRINSIC
low complexity region 131 186 N/A INTRINSIC
low complexity region 190 215 N/A INTRINSIC
ZnF_C3H1 289 315 2.61e-4 SMART
low complexity region 330 389 N/A INTRINSIC
low complexity region 394 409 N/A INTRINSIC
RRM 538 607 7.74e-3 SMART
low complexity region 727 740 N/A INTRINSIC
Blast:RRM_2 758 825 6e-19 BLAST
low complexity region 853 884 N/A INTRINSIC
RRM 897 961 2.1e-1 SMART
low complexity region 975 983 N/A INTRINSIC
low complexity region 986 1001 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163545
AA Change: Q914K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126414
Gene: ENSMUSG00000022119
AA Change: Q914K

DomainStartEndE-ValueType
Pfam:PWI 11 81 1.5e-11 PFAM
low complexity region 102 123 N/A INTRINSIC
low complexity region 131 186 N/A INTRINSIC
low complexity region 190 215 N/A INTRINSIC
ZnF_C3H1 289 315 2.61e-4 SMART
low complexity region 330 389 N/A INTRINSIC
low complexity region 394 409 N/A INTRINSIC
RRM 538 607 7.74e-3 SMART
low complexity region 724 737 N/A INTRINSIC
Blast:RRM_2 755 822 6e-19 BLAST
low complexity region 850 881 N/A INTRINSIC
RRM 894 958 2.1e-1 SMART
low complexity region 972 1004 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172122
AA Change: Q138K

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126804
Gene: ENSMUSG00000022119
AA Change: Q138K

DomainStartEndE-ValueType
Blast:RRM_2 1 46 3e-6 BLAST
low complexity region 74 105 N/A INTRINSIC
Pfam:RRM_1 125 180 1.1e-5 PFAM
Pfam:RRM_5 132 184 1.7e-9 PFAM
low complexity region 196 206 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI

All alleles(33) : Gene trapped(33)

Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh18a1 A T 19: 40,551,314 I739N probably damaging Het
Arfgef1 CAGAG CAG 1: 10,142,586 probably null Het
Ccdc85a T A 11: 28,577,335 probably null Het
D430041D05Rik T C 2: 104,214,177 I825M possibly damaging Het
Evi2 T A 11: 79,515,646 I368F probably benign Het
Greb1 G A 12: 16,702,420 R974W probably damaging Het
Ighv1-7 A G 12: 114,538,646 I67T probably damaging Het
Kcnd2 C G 6: 21,217,263 S322* probably null Het
Lats1 T C 10: 7,705,746 V765A probably damaging Het
Lrrd1 G A 5: 3,851,248 V518I probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
March11 C T 15: 26,387,866 A269V probably damaging Het
Mep1b A G 18: 21,084,169 N115S possibly damaging Het
N4bp1 T C 8: 86,860,427 T628A probably benign Het
Nuak1 C T 10: 84,378,087 probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Parp8 A G 13: 116,894,767 S470P probably benign Het
Pcdhb3 A G 18: 37,303,276 E765G probably damaging Het
Sgcz T C 8: 37,523,411 I263V probably benign Het
Slc15a1 C T 14: 121,484,857 V211I probably benign Het
Slc4a4 T C 5: 89,135,648 F442S possibly damaging Het
Sorcs2 G T 5: 36,397,663 S128* probably null Het
Vmn1r173 T A 7: 23,702,552 F71I probably damaging Het
Other mutations in Rbm26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Rbm26 APN 14 105159960 missense unknown
IGL00948:Rbm26 APN 14 105150343 missense probably damaging 1.00
IGL01584:Rbm26 APN 14 105131532 missense probably damaging 0.99
IGL01726:Rbm26 APN 14 105152507 missense probably damaging 0.99
IGL02095:Rbm26 APN 14 105144260 missense probably damaging 1.00
IGL03306:Rbm26 APN 14 105151322 missense probably damaging 0.99
monte UTSW 14 105142834 missense probably benign 0.12
D4043:Rbm26 UTSW 14 105152540 missense possibly damaging 0.59
I0000:Rbm26 UTSW 14 105153567 missense unknown
R0051:Rbm26 UTSW 14 105152540 missense possibly damaging 0.95
R0051:Rbm26 UTSW 14 105152540 missense possibly damaging 0.95
R0243:Rbm26 UTSW 14 105131938 missense probably benign 0.22
R0738:Rbm26 UTSW 14 105176782 missense unknown
R1566:Rbm26 UTSW 14 105160544 missense unknown
R1645:Rbm26 UTSW 14 105150817 missense probably damaging 1.00
R1789:Rbm26 UTSW 14 105117073 missense probably benign 0.32
R1809:Rbm26 UTSW 14 105117106 splice site probably benign
R2144:Rbm26 UTSW 14 105115202 nonsense probably null
R2321:Rbm26 UTSW 14 105153427 missense unknown
R2495:Rbm26 UTSW 14 105151312 splice site probably benign
R2906:Rbm26 UTSW 14 105142834 missense probably benign 0.12
R2907:Rbm26 UTSW 14 105142834 missense probably benign 0.12
R2908:Rbm26 UTSW 14 105142834 missense probably benign 0.12
R3034:Rbm26 UTSW 14 105153445 missense unknown
R3427:Rbm26 UTSW 14 105131532 missense probably damaging 0.99
R3818:Rbm26 UTSW 14 105141270 missense probably damaging 0.99
R4448:Rbm26 UTSW 14 105151550 missense probably damaging 0.99
R5022:Rbm26 UTSW 14 105144252 missense probably damaging 1.00
R5040:Rbm26 UTSW 14 105121016 missense probably benign 0.05
R5626:Rbm26 UTSW 14 105144231 missense probably benign 0.43
R5817:Rbm26 UTSW 14 105128603 missense probably damaging 1.00
R5960:Rbm26 UTSW 14 105150315 missense probably damaging 1.00
R6318:Rbm26 UTSW 14 105131535 missense probably damaging 0.99
R6608:Rbm26 UTSW 14 105152498 missense probably damaging 1.00
R6821:Rbm26 UTSW 14 105116964 intron probably benign
R7075:Rbm26 UTSW 14 105160607 missense unknown
R7136:Rbm26 UTSW 14 105144267 missense possibly damaging 0.88
R7340:Rbm26 UTSW 14 105152540 missense possibly damaging 0.86
R7431:Rbm26 UTSW 14 105117092 missense possibly damaging 0.71
R7554:Rbm26 UTSW 14 105160593 missense unknown
R7638:Rbm26 UTSW 14 105150848 missense probably damaging 1.00
R8192:Rbm26 UTSW 14 105142689 critical splice donor site probably null
RF004:Rbm26 UTSW 14 105151495 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTACGTTCTGTCAAAGTACAG -3'
(R):5'- CTTGTCATGAGGTGGGAGTAATAAGAC -3'

Sequencing Primer
(F):5'- ACGTTCTGTCAAAGTACAGTTTAAC -3'
(R):5'- GTTGAATGTTGCTAATTCTGGAAAG -3'
Posted On2015-04-06