Incidental Mutation 'R3863:Slc15a1'
ID276440
Institutional Source Beutler Lab
Gene Symbol Slc15a1
Ensembl Gene ENSMUSG00000025557
Gene Namesolute carrier family 15 (oligopeptide transporter), member 1
SynonymsPECT1, PEPT1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R3863 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location121459621-121505252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121484857 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 211 (V211I)
Ref Sequence ENSEMBL: ENSMUSP00000085728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088386]
Predicted Effect probably benign
Transcript: ENSMUST00000088386
AA Change: V211I

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000085728
Gene: ENSMUSG00000025557
AA Change: V211I

DomainStartEndE-ValueType
Pfam:PTR2 81 477 1.9e-141 PFAM
Pfam:PTR2 562 644 4.2e-11 PFAM
transmembrane domain 650 672 N/A INTRINSIC
low complexity region 684 695 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227372
Meta Mutation Damage Score 0.1720 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intestinal hydrogen peptide cotransporter that is a member of the solute carrier family 15. The encoded protein is localized to the brush border membrane of the intestinal epithelium and mediates the uptake of di- and tripeptides from the lumen into the enterocytes. This protein plays an important role in the uptake and digestion of dietary proteins. This protein also facilitates the absorption of numerous peptidomimetic drugs. [provided by RefSeq, Apr 2010]
PHENOTYPE: Peptide uptake in the intestine is substantially reduced in mice homozygous for a null mutation of this gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh18a1 A T 19: 40,551,314 I739N probably damaging Het
Arfgef1 CAGAG CAG 1: 10,142,586 probably null Het
Ccdc85a T A 11: 28,577,335 probably null Het
D430041D05Rik T C 2: 104,214,177 I825M possibly damaging Het
Evi2 T A 11: 79,515,646 I368F probably benign Het
Greb1 G A 12: 16,702,420 R974W probably damaging Het
Ighv1-7 A G 12: 114,538,646 I67T probably damaging Het
Kcnd2 C G 6: 21,217,263 S322* probably null Het
Lats1 T C 10: 7,705,746 V765A probably damaging Het
Lrrd1 G A 5: 3,851,248 V518I probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
March11 C T 15: 26,387,866 A269V probably damaging Het
Mep1b A G 18: 21,084,169 N115S possibly damaging Het
N4bp1 T C 8: 86,860,427 T628A probably benign Het
Nuak1 C T 10: 84,378,087 probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Parp8 A G 13: 116,894,767 S470P probably benign Het
Pcdhb3 A G 18: 37,303,276 E765G probably damaging Het
Rbm26 G T 14: 105,121,068 Q912K probably damaging Het
Sgcz T C 8: 37,523,411 I263V probably benign Het
Slc4a4 T C 5: 89,135,648 F442S possibly damaging Het
Sorcs2 G T 5: 36,397,663 S128* probably null Het
Vmn1r173 T A 7: 23,702,552 F71I probably damaging Het
Other mutations in Slc15a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01337:Slc15a1 APN 14 121460679 missense possibly damaging 0.95
IGL01534:Slc15a1 APN 14 121464952 missense possibly damaging 0.95
IGL01783:Slc15a1 APN 14 121471276 critical splice donor site probably null
IGL01799:Slc15a1 APN 14 121480729 missense possibly damaging 0.76
IGL02064:Slc15a1 APN 14 121462499 missense possibly damaging 0.66
IGL02064:Slc15a1 APN 14 121462474 missense probably benign 0.20
IGL02115:Slc15a1 APN 14 121480661 missense possibly damaging 0.61
IGL02514:Slc15a1 APN 14 121487040 missense probably damaging 1.00
IGL03056:Slc15a1 APN 14 121491283 missense possibly damaging 0.82
IGL03297:Slc15a1 APN 14 121486684 missense probably damaging 1.00
R1484:Slc15a1 UTSW 14 121491239 nonsense probably null
R1532:Slc15a1 UTSW 14 121475984 missense possibly damaging 0.79
R1655:Slc15a1 UTSW 14 121465899 missense probably benign 0.34
R2013:Slc15a1 UTSW 14 121475987 missense possibly damaging 0.88
R2270:Slc15a1 UTSW 14 121479994 missense probably damaging 0.99
R2878:Slc15a1 UTSW 14 121465933 missense probably benign 0.00
R2986:Slc15a1 UTSW 14 121489809 missense probably benign 0.02
R3862:Slc15a1 UTSW 14 121484857 missense probably benign 0.06
R3978:Slc15a1 UTSW 14 121489827 missense probably benign 0.00
R4184:Slc15a1 UTSW 14 121466162 missense probably benign 0.00
R4573:Slc15a1 UTSW 14 121487029 missense probably damaging 0.99
R4604:Slc15a1 UTSW 14 121489907 missense probably damaging 1.00
R4649:Slc15a1 UTSW 14 121478092 missense probably damaging 1.00
R5838:Slc15a1 UTSW 14 121484871 missense probably damaging 1.00
R6221:Slc15a1 UTSW 14 121464904 missense probably null 1.00
R6891:Slc15a1 UTSW 14 121476030 missense probably benign 0.00
R7626:Slc15a1 UTSW 14 121475965 missense probably benign 0.13
R7836:Slc15a1 UTSW 14 121480733 nonsense probably null
R8284:Slc15a1 UTSW 14 121489863 missense probably benign 0.01
R8376:Slc15a1 UTSW 14 121480703 missense probably benign
R8408:Slc15a1 UTSW 14 121478116 missense possibly damaging 0.91
Z1088:Slc15a1 UTSW 14 121480054 missense probably benign 0.09
Z1088:Slc15a1 UTSW 14 121491044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCTCTCCTTCAAAGCAC -3'
(R):5'- TTGGCCATGGCATCAGTGAC -3'

Sequencing Primer
(F):5'- AAAGCACTTTGAGATCTCATTTCCC -3'
(R):5'- GGCATCAGTGACATTAAGACATC -3'
Posted On2015-04-06