Incidental Mutation 'R3864:Scfd2'
ID276454
Institutional Source Beutler Lab
Gene Symbol Scfd2
Ensembl Gene ENSMUSG00000062110
Gene NameSec1 family domain containing 2
SynonymsE430013M20Rik, STXBP1L1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R3864 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location74204816-74531759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 74397720 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 499 (K499Q)
Ref Sequence ENSEMBL: ENSMUSP00000109170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072857] [ENSMUST00000113542] [ENSMUST00000148994]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072857
AA Change: K499Q

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072636
Gene: ENSMUSG00000062110
AA Change: K499Q

DomainStartEndE-ValueType
Pfam:Sec1 25 668 1.4e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113542
AA Change: K499Q

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109170
Gene: ENSMUSG00000062110
AA Change: K499Q

DomainStartEndE-ValueType
low complexity region 471 479 N/A INTRINSIC
low complexity region 506 516 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000148994
AA Change: K7Q
SMART Domains Protein: ENSMUSP00000144640
Gene: ENSMUSG00000062110
AA Change: K7Q

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat G A 11: 116,596,816 G114S probably damaging Het
Abcc4 G A 14: 118,616,415 A360V probably benign Het
BC067074 A G 13: 113,322,951 T1339A possibly damaging Het
Catsper1 T C 19: 5,336,176 S146P possibly damaging Het
Ccny A T 18: 9,449,604 L23Q probably damaging Het
Chml A T 1: 175,688,244 V37D probably damaging Het
D430041D05Rik T C 2: 104,214,177 I825M possibly damaging Het
Dhx40 A T 11: 86,789,245 V422E possibly damaging Het
Evi2 T A 11: 79,515,646 I368F probably benign Het
Gm10309 A C 17: 86,498,993 probably benign Het
Greb1 G A 12: 16,702,420 R974W probably damaging Het
Grhl1 T C 12: 24,615,930 *619Q probably null Het
Ighv1-7 A G 12: 114,538,646 I67T probably damaging Het
Lats1 T C 10: 7,705,746 V765A probably damaging Het
Lrrd1 G A 5: 3,851,248 V518I probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
March11 C T 15: 26,387,866 A269V probably damaging Het
Mep1b A G 18: 21,084,169 N115S possibly damaging Het
Mfn1 A G 3: 32,563,092 D41G possibly damaging Het
Naa25 T A 5: 121,409,197 M132K probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pcdhb3 A G 18: 37,303,276 E765G probably damaging Het
Tbc1d2 T C 4: 46,620,484 D442G probably benign Het
Wwc1 T A 11: 35,910,316 D98V probably damaging Het
Zfp426 G A 9: 20,470,086 T521I possibly damaging Het
Other mutations in Scfd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Scfd2 APN 5 74530934 missense possibly damaging 0.67
IGL01094:Scfd2 APN 5 74531046 missense possibly damaging 0.69
IGL02928:Scfd2 APN 5 74531171 missense probably damaging 1.00
IGL03365:Scfd2 APN 5 74530935 missense possibly damaging 0.67
P0035:Scfd2 UTSW 5 74225319 missense possibly damaging 0.89
R1696:Scfd2 UTSW 5 74530878 missense probably benign
R1857:Scfd2 UTSW 5 74212301 nonsense probably null
R2136:Scfd2 UTSW 5 74206367 missense probably benign 0.01
R2205:Scfd2 UTSW 5 74225367 missense possibly damaging 0.93
R2504:Scfd2 UTSW 5 74531177 missense probably damaging 1.00
R4439:Scfd2 UTSW 5 74397707 missense possibly damaging 0.69
R4590:Scfd2 UTSW 5 74212256 missense probably benign 0.01
R4703:Scfd2 UTSW 5 74519595 missense probably benign 0.00
R4901:Scfd2 UTSW 5 74519565 missense probably damaging 1.00
R4916:Scfd2 UTSW 5 74462658 missense probably damaging 1.00
R4970:Scfd2 UTSW 5 74206321 missense probably benign 0.15
R5112:Scfd2 UTSW 5 74206321 missense probably benign 0.15
R5474:Scfd2 UTSW 5 74531364 missense probably benign 0.24
R5706:Scfd2 UTSW 5 74206398 unclassified probably null
R5766:Scfd2 UTSW 5 74462651 missense probably damaging 1.00
R6769:Scfd2 UTSW 5 74531456 missense probably benign 0.01
R6771:Scfd2 UTSW 5 74531456 missense probably benign 0.01
R6961:Scfd2 UTSW 5 74519541 missense possibly damaging 0.86
R6963:Scfd2 UTSW 5 74482209 missense probably damaging 1.00
R7151:Scfd2 UTSW 5 74397665 missense possibly damaging 0.56
R7159:Scfd2 UTSW 5 74531343 missense probably benign 0.01
R7510:Scfd2 UTSW 5 74212327 missense probably damaging 1.00
R7602:Scfd2 UTSW 5 74462610 missense probably benign 0.32
R7678:Scfd2 UTSW 5 74458636 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCAAGGCTTTGACACCAG -3'
(R):5'- CCTTGGGGATTCAACCATGG -3'

Sequencing Primer
(F):5'- GGCTTTGACACCAGCAACTATG -3'
(R):5'- CCATGGCTGGTGTGCTAAATCAG -3'
Posted On2015-04-06