Incidental Mutation 'R3864:Zfp426'
ID276457
Institutional Source Beutler Lab
Gene Symbol Zfp426
Ensembl Gene ENSMUSG00000059475
Gene Namezinc finger protein 426
SynonymsZfo61, Zfp68-rs1, 2900057C04Rik, KRAB1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R3864 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location20468549-20492746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 20470086 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 521 (T521I)
Ref Sequence ENSEMBL: ENSMUSP00000129727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080386] [ENSMUST00000115562] [ENSMUST00000163348] [ENSMUST00000163427] [ENSMUST00000164799] [ENSMUST00000164825] [ENSMUST00000166005] [ENSMUST00000167457] [ENSMUST00000168095] [ENSMUST00000169269] [ENSMUST00000169558]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080386
AA Change: T521I

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079250
Gene: ENSMUSG00000059475
AA Change: T521I

DomainStartEndE-ValueType
KRAB 39 99 5.56e-31 SMART
ZnF_C2H2 219 241 2.12e-4 SMART
ZnF_C2H2 274 296 1.69e-3 SMART
ZnF_C2H2 302 324 8.81e-2 SMART
ZnF_C2H2 330 352 5.59e-4 SMART
ZnF_C2H2 358 380 3.16e-3 SMART
ZnF_C2H2 386 408 1.43e-1 SMART
ZnF_C2H2 414 436 1.79e-2 SMART
ZnF_C2H2 442 464 1.22e-4 SMART
ZnF_C2H2 470 492 1.38e-3 SMART
ZnF_C2H2 498 520 3.58e-2 SMART
ZnF_C2H2 528 550 3.44e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115562
AA Change: T521I

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111224
Gene: ENSMUSG00000059475
AA Change: T521I

DomainStartEndE-ValueType
KRAB 39 99 5.56e-31 SMART
ZnF_C2H2 219 241 2.12e-4 SMART
ZnF_C2H2 274 296 1.69e-3 SMART
ZnF_C2H2 302 324 8.81e-2 SMART
ZnF_C2H2 330 352 5.59e-4 SMART
ZnF_C2H2 358 380 3.16e-3 SMART
ZnF_C2H2 386 408 1.43e-1 SMART
ZnF_C2H2 414 436 1.79e-2 SMART
ZnF_C2H2 442 464 1.22e-4 SMART
ZnF_C2H2 470 492 1.38e-3 SMART
ZnF_C2H2 498 520 3.58e-2 SMART
ZnF_C2H2 528 550 3.44e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163348
AA Change: T520I

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126446
Gene: ENSMUSG00000059475
AA Change: T520I

DomainStartEndE-ValueType
KRAB 39 99 5.56e-31 SMART
ZnF_C2H2 218 240 2.12e-4 SMART
ZnF_C2H2 273 295 1.69e-3 SMART
ZnF_C2H2 301 323 8.81e-2 SMART
ZnF_C2H2 329 351 5.59e-4 SMART
ZnF_C2H2 357 379 3.16e-3 SMART
ZnF_C2H2 385 407 1.43e-1 SMART
ZnF_C2H2 413 435 1.79e-2 SMART
ZnF_C2H2 441 463 1.22e-4 SMART
ZnF_C2H2 469 491 1.38e-3 SMART
ZnF_C2H2 497 519 3.58e-2 SMART
ZnF_C2H2 527 549 3.44e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163427
Predicted Effect probably benign
Transcript: ENSMUST00000164799
SMART Domains Protein: ENSMUSP00000130120
Gene: ENSMUSG00000059475

DomainStartEndE-ValueType
KRAB 53 93 1.2e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164825
SMART Domains Protein: ENSMUSP00000127914
Gene: ENSMUSG00000059475

DomainStartEndE-ValueType
KRAB 39 99 5.56e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166005
AA Change: T521I

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129727
Gene: ENSMUSG00000059475
AA Change: T521I

DomainStartEndE-ValueType
KRAB 39 99 5.56e-31 SMART
ZnF_C2H2 219 241 2.12e-4 SMART
ZnF_C2H2 274 296 1.69e-3 SMART
ZnF_C2H2 302 324 8.81e-2 SMART
ZnF_C2H2 330 352 5.59e-4 SMART
ZnF_C2H2 358 380 3.16e-3 SMART
ZnF_C2H2 386 408 1.43e-1 SMART
ZnF_C2H2 414 436 1.79e-2 SMART
ZnF_C2H2 442 464 1.22e-4 SMART
ZnF_C2H2 470 492 1.38e-3 SMART
ZnF_C2H2 498 520 3.58e-2 SMART
ZnF_C2H2 528 550 3.44e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166465
Predicted Effect probably benign
Transcript: ENSMUST00000167457
AA Change: T454I

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000130945
Gene: ENSMUSG00000059475
AA Change: T454I

DomainStartEndE-ValueType
KRAB 1 32 1.46e0 SMART
ZnF_C2H2 152 174 2.12e-4 SMART
ZnF_C2H2 207 229 1.69e-3 SMART
ZnF_C2H2 235 257 8.81e-2 SMART
ZnF_C2H2 263 285 5.59e-4 SMART
ZnF_C2H2 291 313 3.16e-3 SMART
ZnF_C2H2 319 341 1.43e-1 SMART
ZnF_C2H2 347 369 1.79e-2 SMART
ZnF_C2H2 375 397 1.22e-4 SMART
ZnF_C2H2 403 425 1.38e-3 SMART
ZnF_C2H2 431 453 3.58e-2 SMART
ZnF_C2H2 461 483 3.44e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168095
SMART Domains Protein: ENSMUSP00000130309
Gene: ENSMUSG00000059475

DomainStartEndE-ValueType
KRAB 39 83 1.37e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169269
SMART Domains Protein: ENSMUSP00000128843
Gene: ENSMUSG00000059475

DomainStartEndE-ValueType
KRAB 39 69 7.16e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169558
AA Change: T535I

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127045
Gene: ENSMUSG00000059475
AA Change: T535I

DomainStartEndE-ValueType
KRAB 53 113 5.56e-31 SMART
ZnF_C2H2 233 255 2.12e-4 SMART
ZnF_C2H2 288 310 1.69e-3 SMART
ZnF_C2H2 316 338 8.81e-2 SMART
ZnF_C2H2 344 366 5.59e-4 SMART
ZnF_C2H2 372 394 3.16e-3 SMART
ZnF_C2H2 400 422 1.43e-1 SMART
ZnF_C2H2 428 450 1.79e-2 SMART
ZnF_C2H2 456 478 1.22e-4 SMART
ZnF_C2H2 484 506 1.38e-3 SMART
ZnF_C2H2 512 534 3.58e-2 SMART
ZnF_C2H2 542 564 3.44e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180846
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kaposi's sarcoma-associated herpesvirus (KSHV) can be reactivated from latency by the viral protein RTA. The protein encoded by this gene is a zinc finger transcriptional repressor that interacts with RTA to modulate RTA-mediated reactivation of KSHV. While the encoded protein can repress KSHV reactivation, RTA can induce degradation of this protein through the ubiquitin-proteasome pathway to overcome the repression. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat G A 11: 116,596,816 G114S probably damaging Het
Abcc4 G A 14: 118,616,415 A360V probably benign Het
BC067074 A G 13: 113,322,951 T1339A possibly damaging Het
Catsper1 T C 19: 5,336,176 S146P possibly damaging Het
Ccny A T 18: 9,449,604 L23Q probably damaging Het
Chml A T 1: 175,688,244 V37D probably damaging Het
D430041D05Rik T C 2: 104,214,177 I825M possibly damaging Het
Dhx40 A T 11: 86,789,245 V422E possibly damaging Het
Evi2 T A 11: 79,515,646 I368F probably benign Het
Gm10309 A C 17: 86,498,993 probably benign Het
Greb1 G A 12: 16,702,420 R974W probably damaging Het
Grhl1 T C 12: 24,615,930 *619Q probably null Het
Ighv1-7 A G 12: 114,538,646 I67T probably damaging Het
Lats1 T C 10: 7,705,746 V765A probably damaging Het
Lrrd1 G A 5: 3,851,248 V518I probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
March11 C T 15: 26,387,866 A269V probably damaging Het
Mep1b A G 18: 21,084,169 N115S possibly damaging Het
Mfn1 A G 3: 32,563,092 D41G possibly damaging Het
Naa25 T A 5: 121,409,197 M132K probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pcdhb3 A G 18: 37,303,276 E765G probably damaging Het
Scfd2 T G 5: 74,397,720 K499Q possibly damaging Het
Tbc1d2 T C 4: 46,620,484 D442G probably benign Het
Wwc1 T A 11: 35,910,316 D98V probably damaging Het
Other mutations in Zfp426
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:Zfp426 APN 9 20478157 start codon destroyed possibly damaging 0.93
IGL02499:Zfp426 APN 9 20473118 splice site probably benign
R0157:Zfp426 UTSW 9 20471136 missense probably benign 0.00
R0356:Zfp426 UTSW 9 20471245 missense probably benign 0.15
R0456:Zfp426 UTSW 9 20470297 missense probably damaging 1.00
R0504:Zfp426 UTSW 9 20470031 missense probably damaging 0.96
R2352:Zfp426 UTSW 9 20470105 missense probably benign 0.08
R2507:Zfp426 UTSW 9 20470431 missense probably benign 0.00
R2509:Zfp426 UTSW 9 20470681 missense possibly damaging 0.68
R3771:Zfp426 UTSW 9 20473117 splice site probably null
R3772:Zfp426 UTSW 9 20473117 splice site probably null
R3773:Zfp426 UTSW 9 20473117 splice site probably null
R4649:Zfp426 UTSW 9 20470627 missense possibly damaging 0.66
R4798:Zfp426 UTSW 9 20471014 missense probably benign 0.17
R4863:Zfp426 UTSW 9 20470038 missense probably damaging 1.00
R4894:Zfp426 UTSW 9 20475073 intron probably benign
R5421:Zfp426 UTSW 9 20470719 missense probably damaging 0.99
R6084:Zfp426 UTSW 9 20470627 missense possibly damaging 0.66
R6610:Zfp426 UTSW 9 20473093 missense probably damaging 1.00
R7239:Zfp426 UTSW 9 20470591 missense probably benign 0.00
R7441:Zfp426 UTSW 9 20470851 missense possibly damaging 0.95
R7646:Zfp426 UTSW 9 20470024 missense probably damaging 0.98
R7827:Zfp426 UTSW 9 20470150 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGTGAGTACCATCATGTCTTC -3'
(R):5'- AAATGTGGGAAAGCCTTTGC -3'

Sequencing Primer
(F):5'- CCATCATGTCTTCAAAGTACATGAGC -3'
(R):5'- GTGGGAAGGCCTTTAACTATTCCAC -3'
Posted On2015-04-06