Incidental Mutation 'R3870:Satb2'
ID276478
Institutional Source Beutler Lab
Gene Symbol Satb2
Ensembl Gene ENSMUSG00000038331
Gene Namespecial AT-rich sequence binding protein 2
Synonyms
MMRRC Submission 040789-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3870 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location56793981-56978650 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56891220 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 215 (S215P)
Ref Sequence ENSEMBL: ENSMUSP00000110057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042857] [ENSMUST00000114415] [ENSMUST00000177424]
Predicted Effect probably damaging
Transcript: ENSMUST00000042857
AA Change: S156P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046067
Gene: ENSMUSG00000038331
AA Change: S156P

DomainStartEndE-ValueType
PDB:3TUO|D 45 98 8e-19 PDB
PDB:3NZL|A 106 174 4e-35 PDB
low complexity region 235 251 N/A INTRINSIC
CUT 292 378 1.3e-36 SMART
low complexity region 381 399 N/A INTRINSIC
CUT 415 501 3.58e-39 SMART
low complexity region 510 524 N/A INTRINSIC
low complexity region 533 551 N/A INTRINSIC
HOX 555 618 1.06e-7 SMART
low complexity region 629 650 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114415
AA Change: S215P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110057
Gene: ENSMUSG00000038331
AA Change: S215P

DomainStartEndE-ValueType
Pfam:ULD 58 156 1.7e-39 PFAM
Pfam:CUTL 162 233 3.9e-46 PFAM
low complexity region 294 310 N/A INTRINSIC
CUT 351 437 1.3e-36 SMART
low complexity region 440 458 N/A INTRINSIC
CUT 474 560 3.58e-39 SMART
low complexity region 569 583 N/A INTRINSIC
low complexity region 592 610 N/A INTRINSIC
HOX 614 677 1.06e-7 SMART
low complexity region 688 709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177424
SMART Domains Protein: ENSMUSP00000135391
Gene: ENSMUSG00000038331

DomainStartEndE-ValueType
PDB:3TUO|D 57 115 6e-23 PDB
low complexity region 176 192 N/A INTRINSIC
CUT 233 319 1.3e-36 SMART
low complexity region 322 340 N/A INTRINSIC
CUT 356 442 3.58e-39 SMART
low complexity region 451 465 N/A INTRINSIC
low complexity region 474 492 N/A INTRINSIC
HOX 496 559 1.06e-7 SMART
low complexity region 570 591 N/A INTRINSIC
Meta Mutation Damage Score 0.2150 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 90% (61/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA binding protein that specifically binds nuclear matrix attachment regions. The encoded protein is involved in transcription regulation and chromatin remodeling. Defects in this gene are associated with isolated cleft palate and mental retardation. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous inactivation of this gene causes complete perinatal lethality and craniofacial anomalies, such as cleft palate, micrognathia, microcephaly, decreased tongue size, absent incisors and nasal capsule hypoplasia, and leads to short limbs and defects in osteoblast differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,231,404 probably null Het
2410089E03Rik A T 15: 8,218,464 K1499M probably damaging Het
Adam22 C A 5: 8,132,418 C514F probably damaging Het
Akap8 G A 17: 32,317,839 probably benign Het
Armcx2 A T X: 134,806,299 V195E probably benign Het
Atg7 T C 6: 114,697,047 S301P possibly damaging Het
Cc2d2a C A 5: 43,718,691 Y1003* probably null Het
Ccdc93 A G 1: 121,463,114 S272G probably benign Het
Ces1d C G 8: 93,175,086 L418F probably benign Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ehd4 T A 2: 120,136,953 D120V probably damaging Het
Eif4g3 T A 4: 138,096,900 V71E probably damaging Het
Exoc5 A G 14: 49,019,396 probably benign Het
Glud1 T A 14: 34,325,580 probably benign Het
Gm10985 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 3: 53,845,205 probably null Het
Gm11555 G T 11: 99,649,990 C64* probably null Het
Gm5468 A G 15: 25,414,475 probably benign Het
Gpatch2 T A 1: 187,322,294 L74Q probably damaging Het
Hnrnpa0 G A 13: 58,127,899 R139C probably damaging Het
Hrh1 A G 6: 114,480,919 Y387C probably damaging Het
Ldb3 A T 14: 34,567,483 D216E probably damaging Het
Lingo1 A T 9: 56,619,725 S533T probably benign Het
Lmtk2 T G 5: 144,166,427 probably benign Het
Map1s A G 8: 70,917,101 E939G possibly damaging Het
Mast1 G A 8: 84,918,731 T695I probably damaging Het
Mettl21e G A 1: 44,206,364 R241W probably benign Het
Mfsd4a G A 1: 132,046,353 T261I probably damaging Het
Mmel1 T C 4: 154,883,638 S144P probably benign Het
Myo16 A T 8: 10,442,239 H727L probably benign Het
Ncoa6 T C 2: 155,415,557 probably null Het
Nipa2 T C 7: 55,932,942 R352G probably damaging Het
Oaf C T 9: 43,222,758 R222Q probably benign Het
Olfr701 T A 7: 106,818,840 Y252* probably null Het
Pard3 T C 8: 127,409,686 S847P probably damaging Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Plcb1 A C 2: 135,325,671 I462L probably damaging Het
Prex2 T C 1: 11,160,192 V814A possibly damaging Het
Rasal3 G A 17: 32,393,548 R780W possibly damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Ryk A G 9: 102,891,228 E359G probably damaging Het
Sall2 C A 14: 52,313,994 L579F probably damaging Het
Scg3 T C 9: 75,675,499 probably benign Het
Slc35f5 A G 1: 125,562,361 T65A probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Stat2 T A 10: 128,277,893 S180R probably benign Het
Stxbp2 A G 8: 3,634,079 T129A probably damaging Het
Tas1r3 A T 4: 155,861,353 C529S probably damaging Het
Tlr12 T A 4: 128,616,568 M630L probably benign Het
Tnfrsf10b T G 14: 69,773,456 D103E probably benign Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Tppp A G 13: 74,030,772 T111A probably benign Het
Trim12c T C 7: 104,348,337 Q4R probably benign Het
Ttbk2 T G 2: 120,740,019 S1149R probably damaging Het
Uncx T C 5: 139,547,365 L395P probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 A T 11: 85,007,055 Y1153* probably null Het
Vmn2r6 T C 3: 64,556,621 E264G probably damaging Het
Vmn2r77 T C 7: 86,811,842 F792S probably damaging Het
Vps13c A G 9: 67,884,726 I425V probably benign Het
Vstm4 C T 14: 32,863,755 A93V probably benign Het
Xrcc6 T A 15: 82,025,684 S97T probably benign Het
Zscan20 A G 4: 128,586,425 C758R probably damaging Het
Other mutations in Satb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Satb2 APN 1 56831541 missense possibly damaging 0.56
IGL02008:Satb2 APN 1 56796793 missense possibly damaging 0.70
IGL02209:Satb2 APN 1 56871518 missense probably damaging 1.00
IGL02956:Satb2 APN 1 56948175 missense probably damaging 0.99
IGL03214:Satb2 APN 1 56845580 missense probably damaging 1.00
IGL03272:Satb2 APN 1 56845643 missense probably damaging 1.00
IGL03356:Satb2 APN 1 56891174 missense probably damaging 1.00
R0990:Satb2 UTSW 1 56850184 missense probably damaging 0.96
R1534:Satb2 UTSW 1 56948233 nonsense probably null
R1711:Satb2 UTSW 1 56850289 missense probably damaging 0.99
R1952:Satb2 UTSW 1 56899070 missense probably damaging 1.00
R2404:Satb2 UTSW 1 56948108 missense probably damaging 1.00
R3792:Satb2 UTSW 1 56845620 missense probably damaging 1.00
R3871:Satb2 UTSW 1 56891220 missense probably damaging 1.00
R4333:Satb2 UTSW 1 56845586 missense probably damaging 1.00
R4621:Satb2 UTSW 1 56845619 missense probably damaging 1.00
R4962:Satb2 UTSW 1 56891168 missense probably benign 0.25
R5296:Satb2 UTSW 1 56796907 missense probably damaging 0.99
R5314:Satb2 UTSW 1 56831527 missense probably damaging 0.99
R5407:Satb2 UTSW 1 56948150 missense probably damaging 1.00
R5925:Satb2 UTSW 1 56796938 missense possibly damaging 0.80
R6355:Satb2 UTSW 1 56948197 missense probably damaging 1.00
R6634:Satb2 UTSW 1 56845721 nonsense probably null
R6645:Satb2 UTSW 1 56797007 missense possibly damaging 0.51
R7578:Satb2 UTSW 1 56871784 missense probably benign 0.01
R7694:Satb2 UTSW 1 56871524 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATGCGTCAGTGCTCATTCC -3'
(R):5'- CGTTTGTAGAGGAGTCATAGCTTTAAG -3'

Sequencing Primer
(F):5'- GTGCTCATTCCAACTTGTTAATCAG -3'
(R):5'- GTCTCTTCTGGTCGCTAA -3'
Posted On2015-04-06