Incidental Mutation 'R3870:Mfsd4a'
ID276482
Institutional Source Beutler Lab
Gene Symbol Mfsd4a
Ensembl Gene ENSMUSG00000059149
Gene Namemajor facilitator superfamily domain containing 4A
SynonymsMfsd4, A930031D07Rik
MMRRC Submission 040789-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R3870 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location132022806-132068062 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132046353 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 261 (T261I)
Ref Sequence ENSEMBL: ENSMUSP00000039635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046658] [ENSMUST00000112365] [ENSMUST00000112370] [ENSMUST00000126927] [ENSMUST00000144548] [ENSMUST00000146267] [ENSMUST00000159038] [ENSMUST00000160656] [ENSMUST00000161864]
Predicted Effect probably damaging
Transcript: ENSMUST00000046658
AA Change: T261I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039635
Gene: ENSMUSG00000059149
AA Change: T261I

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
transmembrane domain 55 74 N/A INTRINSIC
transmembrane domain 81 99 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 218 240 N/A INTRINSIC
transmembrane domain 245 267 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 309 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112365
AA Change: T413I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000107984
Gene: ENSMUSG00000059149
AA Change: T413I

DomainStartEndE-ValueType
Pfam:MFS_1 21 430 1.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112370
AA Change: T413I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000107989
Gene: ENSMUSG00000059149
AA Change: T413I

DomainStartEndE-ValueType
Pfam:MFS_1 21 405 1.1e-11 PFAM
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126927
AA Change: T413I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000116706
Gene: ENSMUSG00000059149
AA Change: T413I

DomainStartEndE-ValueType
Pfam:MFS_1 21 405 1.1e-11 PFAM
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144548
AA Change: T413I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000116282
Gene: ENSMUSG00000059149
AA Change: T413I

DomainStartEndE-ValueType
Pfam:MFS_1 21 396 4.2e-12 PFAM
transmembrane domain 398 420 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146267
SMART Domains Protein: ENSMUSP00000117864
Gene: ENSMUSG00000059149

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
transmembrane domain 55 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159038
AA Change: T413I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000125558
Gene: ENSMUSG00000059149
AA Change: T413I

DomainStartEndE-ValueType
Pfam:MFS_1 20 395 6.8e-12 PFAM
transmembrane domain 398 420 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159382
Predicted Effect probably benign
Transcript: ENSMUST00000160656
AA Change: T307I

PolyPhen 2 Score 0.335 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125138
Gene: ENSMUSG00000059149
AA Change: T307I

DomainStartEndE-ValueType
transmembrane domain 2 20 N/A INTRINSIC
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 85 104 N/A INTRINSIC
transmembrane domain 196 218 N/A INTRINSIC
transmembrane domain 238 257 N/A INTRINSIC
transmembrane domain 269 288 N/A INTRINSIC
transmembrane domain 292 314 N/A INTRINSIC
transmembrane domain 327 349 N/A INTRINSIC
transmembrane domain 354 376 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161864
AA Change: T329I

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124961
Gene: ENSMUSG00000059149
AA Change: T329I

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
transmembrane domain 55 74 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
transmembrane domain 107 126 N/A INTRINSIC
Pfam:MFS_1 218 420 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189227
Meta Mutation Damage Score 0.0975 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 90% (61/68)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,231,404 probably null Het
2410089E03Rik A T 15: 8,218,464 K1499M probably damaging Het
Adam22 C A 5: 8,132,418 C514F probably damaging Het
Akap8 G A 17: 32,317,839 probably benign Het
Armcx2 A T X: 134,806,299 V195E probably benign Het
Atg7 T C 6: 114,697,047 S301P possibly damaging Het
Cc2d2a C A 5: 43,718,691 Y1003* probably null Het
Ccdc93 A G 1: 121,463,114 S272G probably benign Het
Ces1d C G 8: 93,175,086 L418F probably benign Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ehd4 T A 2: 120,136,953 D120V probably damaging Het
Eif4g3 T A 4: 138,096,900 V71E probably damaging Het
Exoc5 A G 14: 49,019,396 probably benign Het
Glud1 T A 14: 34,325,580 probably benign Het
Gm10985 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 3: 53,845,205 probably null Het
Gm11555 G T 11: 99,649,990 C64* probably null Het
Gm5468 A G 15: 25,414,475 probably benign Het
Gpatch2 T A 1: 187,322,294 L74Q probably damaging Het
Hnrnpa0 G A 13: 58,127,899 R139C probably damaging Het
Hrh1 A G 6: 114,480,919 Y387C probably damaging Het
Ldb3 A T 14: 34,567,483 D216E probably damaging Het
Lingo1 A T 9: 56,619,725 S533T probably benign Het
Lmtk2 T G 5: 144,166,427 probably benign Het
Map1s A G 8: 70,917,101 E939G possibly damaging Het
Mast1 G A 8: 84,918,731 T695I probably damaging Het
Mettl21e G A 1: 44,206,364 R241W probably benign Het
Mmel1 T C 4: 154,883,638 S144P probably benign Het
Myo16 A T 8: 10,442,239 H727L probably benign Het
Ncoa6 T C 2: 155,415,557 probably null Het
Nipa2 T C 7: 55,932,942 R352G probably damaging Het
Oaf C T 9: 43,222,758 R222Q probably benign Het
Olfr701 T A 7: 106,818,840 Y252* probably null Het
Pard3 T C 8: 127,409,686 S847P probably damaging Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Plcb1 A C 2: 135,325,671 I462L probably damaging Het
Prex2 T C 1: 11,160,192 V814A possibly damaging Het
Rasal3 G A 17: 32,393,548 R780W possibly damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Ryk A G 9: 102,891,228 E359G probably damaging Het
Sall2 C A 14: 52,313,994 L579F probably damaging Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Scg3 T C 9: 75,675,499 probably benign Het
Slc35f5 A G 1: 125,562,361 T65A probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Stat2 T A 10: 128,277,893 S180R probably benign Het
Stxbp2 A G 8: 3,634,079 T129A probably damaging Het
Tas1r3 A T 4: 155,861,353 C529S probably damaging Het
Tlr12 T A 4: 128,616,568 M630L probably benign Het
Tnfrsf10b T G 14: 69,773,456 D103E probably benign Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Tppp A G 13: 74,030,772 T111A probably benign Het
Trim12c T C 7: 104,348,337 Q4R probably benign Het
Ttbk2 T G 2: 120,740,019 S1149R probably damaging Het
Uncx T C 5: 139,547,365 L395P probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 A T 11: 85,007,055 Y1153* probably null Het
Vmn2r6 T C 3: 64,556,621 E264G probably damaging Het
Vmn2r77 T C 7: 86,811,842 F792S probably damaging Het
Vps13c A G 9: 67,884,726 I425V probably benign Het
Vstm4 C T 14: 32,863,755 A93V probably benign Het
Xrcc6 T A 15: 82,025,684 S97T probably benign Het
Zscan20 A G 4: 128,586,425 C758R probably damaging Het
Other mutations in Mfsd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Mfsd4a APN 1 132040594 missense probably benign 0.34
IGL01348:Mfsd4a APN 1 132067826 missense probably null 0.96
IGL01621:Mfsd4a APN 1 132054143 missense probably benign 0.16
IGL01934:Mfsd4a APN 1 132046311 missense probably damaging 1.00
IGL02429:Mfsd4a APN 1 132028499 missense probably benign
R0362:Mfsd4a UTSW 1 132059275 missense probably damaging 1.00
R0551:Mfsd4a UTSW 1 132041919 missense probably damaging 1.00
R1435:Mfsd4a UTSW 1 132067756 missense probably damaging 1.00
R1566:Mfsd4a UTSW 1 132059179 missense probably damaging 1.00
R1739:Mfsd4a UTSW 1 132067883 missense possibly damaging 0.85
R1793:Mfsd4a UTSW 1 132059339 missense probably damaging 0.98
R1799:Mfsd4a UTSW 1 132053596 missense possibly damaging 0.63
R2244:Mfsd4a UTSW 1 132028505 missense probably benign 0.09
R4177:Mfsd4a UTSW 1 132040557 missense probably damaging 0.99
R4330:Mfsd4a UTSW 1 132053553 missense possibly damaging 0.71
R4705:Mfsd4a UTSW 1 132053571 missense probably damaging 1.00
R4717:Mfsd4a UTSW 1 132057895 missense probably benign 0.00
R5886:Mfsd4a UTSW 1 132067727 missense probably damaging 0.96
R5890:Mfsd4a UTSW 1 132038928 missense probably damaging 1.00
R7092:Mfsd4a UTSW 1 132067663 missense probably benign 0.06
R7189:Mfsd4a UTSW 1 132052393 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACACATAGCCATGGACAG -3'
(R):5'- GCGTCCCTTTCTCTGAGATG -3'

Sequencing Primer
(F):5'- CAACCATGCCAGGAGGTGTTTTG -3'
(R):5'- CTTTCTCTGAGATGCCCGGAG -3'
Posted On2015-04-06