Mutagenetix > Incidental Mutation

Incidental Mutation 'R3870:Lmtk2'

276500

Institutional Source

Beutler Lab

Gene Symbol

Lmtk2

Ensembl Gene

ENSMUSG00000038970

Gene Name

lemur tyrosine kinase 2

Synonyms

AATYK2, A330101P12Rik, KPI2, cprk, KPI-2, 2900041G10Rik, BREK

MMRRC Submission

040789-MU

Accession Numbers

Genbank: NM_001081109; MGI: 3036247

Essential gene?

Possibly non essential (E-score: 0.452) question?

Stock #

R3870 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

144100436-144188204 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to G at 144166427 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000048238 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041804]

AlphaFold

Q3TYD6

Predicted Effect

probably benign
Transcript: ENSMUST00000041804

SMART Domains

Protein: ENSMUSP00000048238
Gene: ENSMUSG00000038970

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
transmembrane domain	42	61	N/A	INTRINSIC
low complexity region	72	88	N/A	INTRINSIC
STYKc	136	406	3.4e-39	SMART
low complexity region	924	953	N/A	INTRINSIC
low complexity region	1019	1035	N/A	INTRINSIC
low complexity region	1104	1117	N/A	INTRINSIC
low complexity region	1168	1180	N/A	INTRINSIC
low complexity region	1252	1266	N/A	INTRINSIC
low complexity region	1354	1367	N/A	INTRINSIC
low complexity region	1380	1392	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.1%

Validation Efficiency

90% (61/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase superfamily and the protein tyrosine kinase family. It contains N-terminal transmembrane helices and a long C-terminal cytoplasmic tail with serine/threonine/tyrosine kinase activity. This protein interacts with several other proteins, such as Inhibitor-2 (Inh2), protein phosphatase-1 (PP1C), p35, and myosin VI. It phosporylates other proteins, and is itself also phosporylated when interacting with cyclin-dependent kinase 5 (cdk5)/p35 complex. This protein involves in nerve growth factor (NGF)-TrkA signalling, and also plays a critical role in endosomal membrane trafficking. Mouse studies suggested an essential role of this protein in spermatogenesis. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null mutation in this gene display partial prenatal lethality, male infertility, and azoospermia. [provided by MGI curators]

Allele List at MGI

All alleles(31) : Targeted, knock-out(1) Gene trapped(30)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028J19Rik	T	A	7: 44,231,404		probably null	Het
2410089E03Rik	A	T	15: 8,218,464	K1499M	probably damaging	Het
Adam22	C	A	5: 8,132,418	C514F	probably damaging	Het
Akap8	G	A	17: 32,317,839		probably benign	Het
Armcx2	A	T	X: 134,806,299	V195E	probably benign	Het
Atg7	T	C	6: 114,697,047	S301P	possibly damaging	Het
Cc2d2a	C	A	5: 43,718,691	Y1003*	probably null	Het
Ccdc93	A	G	1: 121,463,114	S272G	probably benign	Het
Ces1d	C	G	8: 93,175,086	L418F	probably benign	Het
Cntnap5a	A	G	1: 116,060,249	E170G	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Ehd4	T	A	2: 120,136,953	D120V	probably damaging	Het
Eif4g3	T	A	4: 138,096,900	V71E	probably damaging	Het
Exoc5	A	G	14: 49,019,396		probably benign	Het
Glud1	T	A	14: 34,325,580		probably benign	Het
Gm10985	TTCTCTCTCTCTCTCTCT	TTCTCTCTCTCTCTCT	3: 53,845,205		probably null	Het
Gm11555	G	T	11: 99,649,990	C64*	probably null	Het
Gm5468	A	G	15: 25,414,475		probably benign	Het
Gpatch2	T	A	1: 187,322,294	L74Q	probably damaging	Het
Hnrnpa0	G	A	13: 58,127,899	R139C	probably damaging	Het
Hrh1	A	G	6: 114,480,919	Y387C	probably damaging	Het
Ldb3	A	T	14: 34,567,483	D216E	probably damaging	Het
Lingo1	A	T	9: 56,619,725	S533T	probably benign	Het
Map1s	A	G	8: 70,917,101	E939G	possibly damaging	Het
Mast1	G	A	8: 84,918,731	T695I	probably damaging	Het
Mettl21e	G	A	1: 44,206,364	R241W	probably benign	Het
Mfsd4a	G	A	1: 132,046,353	T261I	probably damaging	Het
Mmel1	T	C	4: 154,883,638	S144P	probably benign	Het
Myo16	A	T	8: 10,442,239	H727L	probably benign	Het
Ncoa6	T	C	2: 155,415,557		probably null	Het
Nipa2	T	C	7: 55,932,942	R352G	probably damaging	Het
Oaf	C	T	9: 43,222,758	R222Q	probably benign	Het
Olfr701	T	A	7: 106,818,840	Y252*	probably null	Het
Pard3	T	C	8: 127,409,686	S847P	probably damaging	Het
Pgbd1	C	T	13: 21,434,370	R39H	possibly damaging	Het
Plcb1	A	C	2: 135,325,671	I462L	probably damaging	Het
Prex2	T	C	1: 11,160,192	V814A	possibly damaging	Het
Rasal3	G	A	17: 32,393,548	R780W	possibly damaging	Het
Rubcnl	C	T	14: 75,040,916	P380L	probably benign	Het
Ryk	A	G	9: 102,891,228	E359G	probably damaging	Het
Sall2	C	A	14: 52,313,994	L579F	probably damaging	Het
Satb2	A	G	1: 56,891,220	S215P	probably damaging	Het
Scg3	T	C	9: 75,675,499		probably benign	Het
Slc35f5	A	G	1: 125,562,361	T65A	probably benign	Het
Snx33	T	C	9: 56,926,740	N15S	probably benign	Het
Stat2	T	A	10: 128,277,893	S180R	probably benign	Het
Stxbp2	A	G	8: 3,634,079	T129A	probably damaging	Het
Tas1r3	A	T	4: 155,861,353	C529S	probably damaging	Het
Tlr12	T	A	4: 128,616,568	M630L	probably benign	Het
Tnfrsf10b	T	G	14: 69,773,456	D103E	probably benign	Het
Togaram1	A	C	12: 65,002,645	E1285D	probably benign	Het
Tppp	A	G	13: 74,030,772	T111A	probably benign	Het
Trim12c	T	C	7: 104,348,337	Q4R	probably benign	Het
Ttbk2	T	G	2: 120,740,019	S1149R	probably damaging	Het
Uncx	T	C	5: 139,547,365	L395P	probably damaging	Het
Usp14	A	G	18: 10,002,370	S314P	possibly damaging	Het
Usp32	A	T	11: 85,007,055	Y1153*	probably null	Het
Vmn2r6	T	C	3: 64,556,621	E264G	probably damaging	Het
Vmn2r77	T	C	7: 86,811,842	F792S	probably damaging	Het
Vps13c	A	G	9: 67,884,726	I425V	probably benign	Het
Vstm4	C	T	14: 32,863,755	A93V	probably benign	Het
Xrcc6	T	A	15: 82,025,684	S97T	probably benign	Het
Zscan20	A	G	4: 128,586,425	C758R	probably damaging	Het

Other mutations in Lmtk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Lmtk2	APN	5	144134155	missense	probably damaging	1.00
IGL00496:Lmtk2	APN	5	144174694	missense	probably benign
IGL00848:Lmtk2	APN	5	144176398	missense	probably benign
IGL01450:Lmtk2	APN	5	144174702	missense	probably benign	0.03
IGL01833:Lmtk2	APN	5	144175935	nonsense	probably null
IGL01967:Lmtk2	APN	5	144182779	missense	probably benign
IGL01998:Lmtk2	APN	5	144176065	missense	probably damaging	1.00
IGL02106:Lmtk2	APN	5	144175951	missense	probably benign	0.03
IGL02147:Lmtk2	APN	5	144156936	missense	possibly damaging	0.78
IGL02581:Lmtk2	APN	5	144148348	missense	probably damaging	1.00
madagascar	UTSW	5	144174919	missense	probably benign	0.02
A4554:Lmtk2	UTSW	5	144166317	missense	possibly damaging	0.82
R0039:Lmtk2	UTSW	5	144166387	missense	probably damaging	1.00
R0039:Lmtk2	UTSW	5	144166387	missense	probably damaging	1.00
R0108:Lmtk2	UTSW	5	144174285	missense	possibly damaging	0.78
R0367:Lmtk2	UTSW	5	144174285	missense	possibly damaging	0.78
R0515:Lmtk2	UTSW	5	144174991	missense	possibly damaging	0.77
R1434:Lmtk2	UTSW	5	144174589	missense	probably damaging	1.00
R1617:Lmtk2	UTSW	5	144173862	missense	probably damaging	1.00
R1760:Lmtk2	UTSW	5	144174175	missense	probably damaging	0.99
R1785:Lmtk2	UTSW	5	144174988	missense	possibly damaging	0.61
R1786:Lmtk2	UTSW	5	144174988	missense	possibly damaging	0.61
R1907:Lmtk2	UTSW	5	144175110	missense	probably benign	0.00
R2130:Lmtk2	UTSW	5	144174988	missense	possibly damaging	0.61
R2131:Lmtk2	UTSW	5	144174988	missense	possibly damaging	0.61
R2132:Lmtk2	UTSW	5	144174988	missense	possibly damaging	0.61
R2133:Lmtk2	UTSW	5	144174988	missense	possibly damaging	0.61
R2140:Lmtk2	UTSW	5	144147615	missense	probably damaging	1.00
R2141:Lmtk2	UTSW	5	144147615	missense	probably damaging	1.00
R2210:Lmtk2	UTSW	5	144147609	missense	probably damaging	1.00
R2289:Lmtk2	UTSW	5	144176106	missense	possibly damaging	0.80
R2312:Lmtk2	UTSW	5	144173626	missense	probably damaging	1.00
R2352:Lmtk2	UTSW	5	144173911	missense	probably benign	0.05
R4011:Lmtk2	UTSW	5	144175879	missense	probably benign	0.01
R4272:Lmtk2	UTSW	5	144183226	missense	probably benign	0.05
R4361:Lmtk2	UTSW	5	144147664	missense	probably damaging	1.00
R4580:Lmtk2	UTSW	5	144174781	missense	possibly damaging	0.56
R4621:Lmtk2	UTSW	5	144174934	missense	probably benign	0.02
R4981:Lmtk2	UTSW	5	144176447	missense	probably damaging	1.00
R5818:Lmtk2	UTSW	5	144156900	missense	probably benign	0.07
R5984:Lmtk2	UTSW	5	144174838	missense	probably benign
R6083:Lmtk2	UTSW	5	144182756	missense	probably damaging	1.00
R6180:Lmtk2	UTSW	5	144175342	missense	probably damaging	1.00
R6411:Lmtk2	UTSW	5	144174586	missense	probably damaging	0.99
R6544:Lmtk2	UTSW	5	144173806	missense	possibly damaging	0.68
R6628:Lmtk2	UTSW	5	144174685	missense	probably benign	0.03
R6698:Lmtk2	UTSW	5	144174919	missense	probably benign	0.02
R6742:Lmtk2	UTSW	5	144148357	missense	probably damaging	1.00
R6763:Lmtk2	UTSW	5	144173797	missense	probably damaging	1.00
R7286:Lmtk2	UTSW	5	144174360	nonsense	probably null
R7390:Lmtk2	UTSW	5	144129443	missense	possibly damaging	0.79
R7594:Lmtk2	UTSW	5	144173746	missense	probably damaging	1.00
R7660:Lmtk2	UTSW	5	144148340	missense	probably damaging	1.00
R7785:Lmtk2	UTSW	5	144174753	missense	probably benign	0.00
R7977:Lmtk2	UTSW	5	144175141	missense	probably benign	0.02
R7987:Lmtk2	UTSW	5	144175141	missense	probably benign	0.02
R8089:Lmtk2	UTSW	5	144156900	missense	probably benign	0.07
R8138:Lmtk2	UTSW	5	144175597	missense	probably damaging	0.99
R8694:Lmtk2	UTSW	5	144171748	missense	probably damaging	1.00
R8714:Lmtk2	UTSW	5	144176058	missense	probably damaging	1.00
R8816:Lmtk2	UTSW	5	144175975	nonsense	probably null
R8845:Lmtk2	UTSW	5	144173886	missense	probably damaging	1.00
R8856:Lmtk2	UTSW	5	144176261	missense	probably damaging	1.00
R9306:Lmtk2	UTSW	5	144182781	missense	probably benign	0.17
R9494:Lmtk2	UTSW	5	144100520	start gained	probably benign
X0024:Lmtk2	UTSW	5	144174250	missense	probably benign	0.22
Z1088:Lmtk2	UTSW	5	144182851	missense	probably benign	0.12

Predicted Primers

PCR Primer
(F):5'- AGCTCCCCTCACATGGAATTC -3'
(R):5'- TAACAGCCCAAACCTCTCAGTTTTC -3'

Sequencing Primer
(F):5'- ATGGAATTCCCCTGAACACTGTG -3'
(R):5'- AAGCACTTACTGTATTCCAGGCCG -3'

Posted On

2015-04-06