Incidental Mutation 'R3870:Stxbp2'
ID276508
Institutional Source Beutler Lab
Gene Symbol Stxbp2
Ensembl Gene ENSMUSG00000004626
Gene Namesyntaxin binding protein 2
SynonymsmuSec1, Munc18b, Munc-18-2, C79054, Sxtp2, Munc-18b
MMRRC Submission 040789-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3870 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location3630955-3643644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3634079 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 129 (T129A)
Ref Sequence ENSEMBL: ENSMUSP00000125405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159888] [ENSMUST00000159911] [ENSMUST00000160708] [ENSMUST00000162867]
Predicted Effect unknown
Transcript: ENSMUST00000004745
AA Change: T128A
SMART Domains Protein: ENSMUSP00000004745
Gene: ENSMUSG00000004626
AA Change: T128A

DomainStartEndE-ValueType
Pfam:Sec1 29 580 6.8e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159888
Predicted Effect probably benign
Transcript: ENSMUST00000159911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160435
Predicted Effect probably damaging
Transcript: ENSMUST00000160708
AA Change: T129A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125405
Gene: ENSMUSG00000004626
AA Change: T129A

DomainStartEndE-ValueType
Pfam:Sec1 29 579 4.9e-112 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162737
Predicted Effect probably benign
Transcript: ENSMUST00000162867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163044
Meta Mutation Damage Score 0.2401 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 90% (61/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the STXBP/unc-18/SEC1 family. The encoded protein is involved in intracellular trafficking, control of SNARE (soluble NSF attachment protein receptor) complex assembly, and the release of cytotoxic granules by natural killer cells. Mutations in this gene are associated with familial hemophagocytic lymphohistiocytosis. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete preweaning lethality. Mice heterozygous for this allele exhibit decreased stimulated mucin secretion, release of histones in stimulated mast cells and decreased susceptibility to type I hypersensitivity reaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,231,404 probably null Het
2410089E03Rik A T 15: 8,218,464 K1499M probably damaging Het
Adam22 C A 5: 8,132,418 C514F probably damaging Het
Akap8 G A 17: 32,317,839 probably benign Het
Armcx2 A T X: 134,806,299 V195E probably benign Het
Atg7 T C 6: 114,697,047 S301P possibly damaging Het
Cc2d2a C A 5: 43,718,691 Y1003* probably null Het
Ccdc93 A G 1: 121,463,114 S272G probably benign Het
Ces1d C G 8: 93,175,086 L418F probably benign Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ehd4 T A 2: 120,136,953 D120V probably damaging Het
Eif4g3 T A 4: 138,096,900 V71E probably damaging Het
Exoc5 A G 14: 49,019,396 probably benign Het
Glud1 T A 14: 34,325,580 probably benign Het
Gm10985 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 3: 53,845,205 probably null Het
Gm11555 G T 11: 99,649,990 C64* probably null Het
Gm5468 A G 15: 25,414,475 probably benign Het
Gpatch2 T A 1: 187,322,294 L74Q probably damaging Het
Hnrnpa0 G A 13: 58,127,899 R139C probably damaging Het
Hrh1 A G 6: 114,480,919 Y387C probably damaging Het
Ldb3 A T 14: 34,567,483 D216E probably damaging Het
Lingo1 A T 9: 56,619,725 S533T probably benign Het
Lmtk2 T G 5: 144,166,427 probably benign Het
Map1s A G 8: 70,917,101 E939G possibly damaging Het
Mast1 G A 8: 84,918,731 T695I probably damaging Het
Mettl21e G A 1: 44,206,364 R241W probably benign Het
Mfsd4a G A 1: 132,046,353 T261I probably damaging Het
Mmel1 T C 4: 154,883,638 S144P probably benign Het
Myo16 A T 8: 10,442,239 H727L probably benign Het
Ncoa6 T C 2: 155,415,557 probably null Het
Nipa2 T C 7: 55,932,942 R352G probably damaging Het
Oaf C T 9: 43,222,758 R222Q probably benign Het
Olfr701 T A 7: 106,818,840 Y252* probably null Het
Pard3 T C 8: 127,409,686 S847P probably damaging Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Plcb1 A C 2: 135,325,671 I462L probably damaging Het
Prex2 T C 1: 11,160,192 V814A possibly damaging Het
Rasal3 G A 17: 32,393,548 R780W possibly damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Ryk A G 9: 102,891,228 E359G probably damaging Het
Sall2 C A 14: 52,313,994 L579F probably damaging Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Scg3 T C 9: 75,675,499 probably benign Het
Slc35f5 A G 1: 125,562,361 T65A probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Stat2 T A 10: 128,277,893 S180R probably benign Het
Tas1r3 A T 4: 155,861,353 C529S probably damaging Het
Tlr12 T A 4: 128,616,568 M630L probably benign Het
Tnfrsf10b T G 14: 69,773,456 D103E probably benign Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Tppp A G 13: 74,030,772 T111A probably benign Het
Trim12c T C 7: 104,348,337 Q4R probably benign Het
Ttbk2 T G 2: 120,740,019 S1149R probably damaging Het
Uncx T C 5: 139,547,365 L395P probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 A T 11: 85,007,055 Y1153* probably null Het
Vmn2r6 T C 3: 64,556,621 E264G probably damaging Het
Vmn2r77 T C 7: 86,811,842 F792S probably damaging Het
Vps13c A G 9: 67,884,726 I425V probably benign Het
Vstm4 C T 14: 32,863,755 A93V probably benign Het
Xrcc6 T A 15: 82,025,684 S97T probably benign Het
Zscan20 A G 4: 128,586,425 C758R probably damaging Het
Other mutations in Stxbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Stxbp2 APN 8 3636354 critical splice acceptor site probably null
IGL00466:Stxbp2 APN 8 3634065 missense probably benign 0.29
IGL02315:Stxbp2 APN 8 3635607 unclassified probably benign
IGL02508:Stxbp2 APN 8 3632531 missense probably damaging 1.00
IGL02811:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02833:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02868:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02869:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02896:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02926:Stxbp2 APN 8 3635629 missense probably benign 0.31
IGL02927:Stxbp2 APN 8 3642685 missense possibly damaging 0.95
IGL02928:Stxbp2 APN 8 3641736 missense probably damaging 0.99
IGL02943:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02945:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02948:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02951:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02972:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02976:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02977:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02983:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02993:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03008:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03009:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03038:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03051:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03061:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03072:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03110:Stxbp2 APN 8 3633342 missense probably damaging 1.00
IGL02988:Stxbp2 UTSW 8 3633267 intron probably benign
R0463:Stxbp2 UTSW 8 3632559 missense probably damaging 1.00
R0608:Stxbp2 UTSW 8 3632559 missense probably damaging 1.00
R0755:Stxbp2 UTSW 8 3642019 missense probably benign 0.01
R1328:Stxbp2 UTSW 8 3642657 missense possibly damaging 0.56
R1771:Stxbp2 UTSW 8 3634064 missense probably benign 0.01
R1962:Stxbp2 UTSW 8 3642672 missense probably benign 0.00
R2195:Stxbp2 UTSW 8 3634615 synonymous probably null
R2319:Stxbp2 UTSW 8 3633834 missense possibly damaging 0.95
R3614:Stxbp2 UTSW 8 3631196 missense possibly damaging 0.94
R3876:Stxbp2 UTSW 8 3633369 critical splice donor site probably null
R4703:Stxbp2 UTSW 8 3632521 missense probably damaging 1.00
R6533:Stxbp2 UTSW 8 3642683 missense probably benign 0.01
R6623:Stxbp2 UTSW 8 3632561 missense probably damaging 1.00
R6665:Stxbp2 UTSW 8 3641998 missense probably benign 0.41
R6798:Stxbp2 UTSW 8 3641180 missense probably benign
R7152:Stxbp2 UTSW 8 3632583 missense probably benign 0.33
R7326:Stxbp2 UTSW 8 3641151 missense
Predicted Primers PCR Primer
(F):5'- ATTGCGGACTTCCAGGGAAC -3'
(R):5'- CTAGGAATGTGCACAAGGCTAG -3'

Sequencing Primer
(F):5'- CAAAGCAGCCCATATCTTCTTCACTG -3'
(R):5'- GCTAGGGCCCCAGGAAAG -3'
Posted On2015-04-06