Incidental Mutation 'R3870:Usp32'
ID276525
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Nameubiquitin specific peptidase 32
Synonyms6430526O11Rik, 2900074J03Rik
MMRRC Submission 040789-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3870 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location84984442-85140161 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 85007055 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1153 (Y1153*)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
Predicted Effect probably benign
Transcript: ENSMUST00000000821
SMART Domains Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Pfam:UCH 32 260 4.1e-51 PFAM
Pfam:UCH_1 33 228 1.7e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108075
AA Change: Y1153*
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: Y1153*

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 90% (61/68)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,231,404 probably null Het
2410089E03Rik A T 15: 8,218,464 K1499M probably damaging Het
Adam22 C A 5: 8,132,418 C514F probably damaging Het
Akap8 G A 17: 32,317,839 probably benign Het
Armcx2 A T X: 134,806,299 V195E probably benign Het
Atg7 T C 6: 114,697,047 S301P possibly damaging Het
Cc2d2a C A 5: 43,718,691 Y1003* probably null Het
Ccdc93 A G 1: 121,463,114 S272G probably benign Het
Ces1d C G 8: 93,175,086 L418F probably benign Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ehd4 T A 2: 120,136,953 D120V probably damaging Het
Eif4g3 T A 4: 138,096,900 V71E probably damaging Het
Exoc5 A G 14: 49,019,396 probably benign Het
Glud1 T A 14: 34,325,580 probably benign Het
Gm10985 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 3: 53,845,205 probably null Het
Gm11555 G T 11: 99,649,990 C64* probably null Het
Gm5468 A G 15: 25,414,475 probably benign Het
Gpatch2 T A 1: 187,322,294 L74Q probably damaging Het
Hnrnpa0 G A 13: 58,127,899 R139C probably damaging Het
Hrh1 A G 6: 114,480,919 Y387C probably damaging Het
Ldb3 A T 14: 34,567,483 D216E probably damaging Het
Lingo1 A T 9: 56,619,725 S533T probably benign Het
Lmtk2 T G 5: 144,166,427 probably benign Het
Map1s A G 8: 70,917,101 E939G possibly damaging Het
Mast1 G A 8: 84,918,731 T695I probably damaging Het
Mettl21e G A 1: 44,206,364 R241W probably benign Het
Mfsd4a G A 1: 132,046,353 T261I probably damaging Het
Mmel1 T C 4: 154,883,638 S144P probably benign Het
Myo16 A T 8: 10,442,239 H727L probably benign Het
Ncoa6 T C 2: 155,415,557 probably null Het
Nipa2 T C 7: 55,932,942 R352G probably damaging Het
Oaf C T 9: 43,222,758 R222Q probably benign Het
Olfr701 T A 7: 106,818,840 Y252* probably null Het
Pard3 T C 8: 127,409,686 S847P probably damaging Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Plcb1 A C 2: 135,325,671 I462L probably damaging Het
Prex2 T C 1: 11,160,192 V814A possibly damaging Het
Rasal3 G A 17: 32,393,548 R780W possibly damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Ryk A G 9: 102,891,228 E359G probably damaging Het
Sall2 C A 14: 52,313,994 L579F probably damaging Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Scg3 T C 9: 75,675,499 probably benign Het
Slc35f5 A G 1: 125,562,361 T65A probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Stat2 T A 10: 128,277,893 S180R probably benign Het
Stxbp2 A G 8: 3,634,079 T129A probably damaging Het
Tas1r3 A T 4: 155,861,353 C529S probably damaging Het
Tlr12 T A 4: 128,616,568 M630L probably benign Het
Tnfrsf10b T G 14: 69,773,456 D103E probably benign Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Tppp A G 13: 74,030,772 T111A probably benign Het
Trim12c T C 7: 104,348,337 Q4R probably benign Het
Ttbk2 T G 2: 120,740,019 S1149R probably damaging Het
Uncx T C 5: 139,547,365 L395P probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Vmn2r6 T C 3: 64,556,621 E264G probably damaging Het
Vmn2r77 T C 7: 86,811,842 F792S probably damaging Het
Vps13c A G 9: 67,884,726 I425V probably benign Het
Vstm4 C T 14: 32,863,755 A93V probably benign Het
Xrcc6 T A 15: 82,025,684 S97T probably benign Het
Zscan20 A G 4: 128,586,425 C758R probably damaging Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7186:Usp32 UTSW 11 85051234 missense probably benign 0.45
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
R7469:Usp32 UTSW 11 84988553 missense possibly damaging 0.94
R7502:Usp32 UTSW 11 85022898 missense possibly damaging 0.48
R7513:Usp32 UTSW 11 85027112 nonsense probably null
R7629:Usp32 UTSW 11 85019855 frame shift probably null
R7703:Usp32 UTSW 11 85077327 missense probably damaging 0.99
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CACAAAGAAGAGATGGACAATTCTC -3'
(R):5'- TTTGGGTTATACAGAAAGAGCTCC -3'

Sequencing Primer
(F):5'- GACTCTGTGAGACTGGTTT -3'
(R):5'- GTTATACAGAAAGAGCTCCTGTGCC -3'
Posted On2015-04-06