Incidental Mutation 'R3870:Sall2'
ID276535
Institutional Source Beutler Lab
Gene Symbol Sall2
Ensembl Gene ENSMUSG00000049532
Gene Namespalt like transcription factor 2
SynonymsMsal-2
MMRRC Submission 040789-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3870 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location52311172-52328762 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 52313994 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 579 (L579F)
Ref Sequence ENSEMBL: ENSMUSP00000154331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]
Predicted Effect probably damaging
Transcript: ENSMUST00000058326
AA Change: L581F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: L581F

DomainStartEndE-ValueType
low complexity region 71 81 N/A INTRINSIC
low complexity region 97 110 N/A INTRINSIC
low complexity region 128 139 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
ZnF_C2H2 372 394 2.57e-3 SMART
ZnF_C2H2 400 422 1.28e-3 SMART
low complexity region 476 501 N/A INTRINSIC
low complexity region 602 627 N/A INTRINSIC
ZnF_C2H2 629 651 1.2e1 SMART
ZnF_C2H2 657 679 1.69e-3 SMART
ZnF_C2H2 689 711 6.88e-4 SMART
low complexity region 719 730 N/A INTRINSIC
low complexity region 747 779 N/A INTRINSIC
low complexity region 799 819 N/A INTRINSIC
low complexity region 829 848 N/A INTRINSIC
ZnF_C2H2 908 930 2.09e-3 SMART
ZnF_C2H2 937 960 1.01e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135523
AA Change: L579F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4398 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 90% (61/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,231,404 probably null Het
2410089E03Rik A T 15: 8,218,464 K1499M probably damaging Het
Adam22 C A 5: 8,132,418 C514F probably damaging Het
Akap8 G A 17: 32,317,839 probably benign Het
Armcx2 A T X: 134,806,299 V195E probably benign Het
Atg7 T C 6: 114,697,047 S301P possibly damaging Het
Cc2d2a C A 5: 43,718,691 Y1003* probably null Het
Ccdc93 A G 1: 121,463,114 S272G probably benign Het
Ces1d C G 8: 93,175,086 L418F probably benign Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ehd4 T A 2: 120,136,953 D120V probably damaging Het
Eif4g3 T A 4: 138,096,900 V71E probably damaging Het
Exoc5 A G 14: 49,019,396 probably benign Het
Glud1 T A 14: 34,325,580 probably benign Het
Gm10985 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 3: 53,845,205 probably null Het
Gm11555 G T 11: 99,649,990 C64* probably null Het
Gm5468 A G 15: 25,414,475 probably benign Het
Gpatch2 T A 1: 187,322,294 L74Q probably damaging Het
Hnrnpa0 G A 13: 58,127,899 R139C probably damaging Het
Hrh1 A G 6: 114,480,919 Y387C probably damaging Het
Ldb3 A T 14: 34,567,483 D216E probably damaging Het
Lingo1 A T 9: 56,619,725 S533T probably benign Het
Lmtk2 T G 5: 144,166,427 probably benign Het
Map1s A G 8: 70,917,101 E939G possibly damaging Het
Mast1 G A 8: 84,918,731 T695I probably damaging Het
Mettl21e G A 1: 44,206,364 R241W probably benign Het
Mfsd4a G A 1: 132,046,353 T261I probably damaging Het
Mmel1 T C 4: 154,883,638 S144P probably benign Het
Myo16 A T 8: 10,442,239 H727L probably benign Het
Ncoa6 T C 2: 155,415,557 probably null Het
Nipa2 T C 7: 55,932,942 R352G probably damaging Het
Oaf C T 9: 43,222,758 R222Q probably benign Het
Olfr701 T A 7: 106,818,840 Y252* probably null Het
Pard3 T C 8: 127,409,686 S847P probably damaging Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Plcb1 A C 2: 135,325,671 I462L probably damaging Het
Prex2 T C 1: 11,160,192 V814A possibly damaging Het
Rasal3 G A 17: 32,393,548 R780W possibly damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Ryk A G 9: 102,891,228 E359G probably damaging Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Scg3 T C 9: 75,675,499 probably benign Het
Slc35f5 A G 1: 125,562,361 T65A probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Stat2 T A 10: 128,277,893 S180R probably benign Het
Stxbp2 A G 8: 3,634,079 T129A probably damaging Het
Tas1r3 A T 4: 155,861,353 C529S probably damaging Het
Tlr12 T A 4: 128,616,568 M630L probably benign Het
Tnfrsf10b T G 14: 69,773,456 D103E probably benign Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Tppp A G 13: 74,030,772 T111A probably benign Het
Trim12c T C 7: 104,348,337 Q4R probably benign Het
Ttbk2 T G 2: 120,740,019 S1149R probably damaging Het
Uncx T C 5: 139,547,365 L395P probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 A T 11: 85,007,055 Y1153* probably null Het
Vmn2r6 T C 3: 64,556,621 E264G probably damaging Het
Vmn2r77 T C 7: 86,811,842 F792S probably damaging Het
Vps13c A G 9: 67,884,726 I425V probably benign Het
Vstm4 C T 14: 32,863,755 A93V probably benign Het
Xrcc6 T A 15: 82,025,684 S97T probably benign Het
Zscan20 A G 4: 128,586,425 C758R probably damaging Het
Other mutations in Sall2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01587:Sall2 APN 14 52314571 missense probably damaging 1.00
IGL02152:Sall2 APN 14 52315514 missense probably damaging 1.00
IGL02318:Sall2 APN 14 52315565 missense probably damaging 1.00
IGL02933:Sall2 APN 14 52313027 missense probably benign 0.00
IGL03165:Sall2 APN 14 52314168 missense probably damaging 1.00
R1079:Sall2 UTSW 14 52313203 missense probably benign 0.13
R1295:Sall2 UTSW 14 52313725 missense probably damaging 1.00
R1674:Sall2 UTSW 14 52313836 missense probably damaging 1.00
R1840:Sall2 UTSW 14 52313725 missense probably damaging 1.00
R1989:Sall2 UTSW 14 52314439 missense probably damaging 1.00
R2339:Sall2 UTSW 14 52313356 missense probably damaging 1.00
R3407:Sall2 UTSW 14 52328104 missense probably benign 0.03
R3895:Sall2 UTSW 14 52314047 missense probably damaging 0.99
R4059:Sall2 UTSW 14 52314571 missense probably damaging 1.00
R4272:Sall2 UTSW 14 52313803 missense probably damaging 1.00
R4273:Sall2 UTSW 14 52313803 missense probably damaging 1.00
R4275:Sall2 UTSW 14 52313803 missense probably damaging 1.00
R4289:Sall2 UTSW 14 52313803 missense probably damaging 1.00
R4503:Sall2 UTSW 14 52313459 missense probably benign
R4592:Sall2 UTSW 14 52313803 missense probably damaging 1.00
R4611:Sall2 UTSW 14 52313753 missense probably damaging 1.00
R4615:Sall2 UTSW 14 52312750 missense probably benign 0.20
R4640:Sall2 UTSW 14 52315159 missense probably damaging 0.99
R4693:Sall2 UTSW 14 52314478 missense probably damaging 1.00
R4921:Sall2 UTSW 14 52315393 missense possibly damaging 0.93
R5007:Sall2 UTSW 14 52314493 missense probably damaging 1.00
R5015:Sall2 UTSW 14 52315655 missense possibly damaging 0.92
R5079:Sall2 UTSW 14 52314754 missense probably damaging 1.00
R5419:Sall2 UTSW 14 52313129 missense probably damaging 1.00
R5849:Sall2 UTSW 14 52314247 missense probably benign 0.13
R6229:Sall2 UTSW 14 52313191 missense probably benign
R6397:Sall2 UTSW 14 52315153 missense probably damaging 1.00
R6422:Sall2 UTSW 14 52312724 makesense probably null
R6456:Sall2 UTSW 14 52313593 missense probably damaging 1.00
R6456:Sall2 UTSW 14 52313594 nonsense probably null
R6786:Sall2 UTSW 14 52314621 missense probably damaging 1.00
R7293:Sall2 UTSW 14 52314411 nonsense probably null
R7496:Sall2 UTSW 14 52315561 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TTGGCCATAATGCAGGCGTAG -3'
(R):5'- CTCATGAAGGCAGTGGAACC -3'

Sequencing Primer
(F):5'- CGAGGGCAGCTCAGGAC -3'
(R):5'- TAAAGCGGATGAGAACACGCC -3'
Posted On2015-04-06