Incidental Mutation 'R3870:Akap8'
ID 276543
Institutional Source Beutler Lab
Gene Symbol Akap8
Ensembl Gene ENSMUSG00000024045
Gene Name A kinase (PRKA) anchor protein 8
Synonyms 1200016A02Rik, AKAP95
MMRRC Submission 040789-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3870 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 32303676-32321153 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) G to A at 32317839 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000051389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002699] [ENSMUST00000050214]
AlphaFold Q9DBR0
Predicted Effect probably benign
Transcript: ENSMUST00000002699
SMART Domains Protein: ENSMUSP00000002699
Gene: ENSMUSG00000024045

DomainStartEndE-ValueType
SCOP:d1a0tp_ 12 108 3e-19 SMART
low complexity region 183 198 N/A INTRINSIC
low complexity region 257 270 N/A INTRINSIC
low complexity region 354 384 N/A INTRINSIC
ZnF_C2H2 387 411 9.46e0 SMART
Blast:ZnF_C2H2 476 501 9e-9 BLAST
low complexity region 551 582 N/A INTRINSIC
low complexity region 642 651 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050214
SMART Domains Protein: ENSMUSP00000051389
Gene: ENSMUSG00000002625

DomainStartEndE-ValueType
low complexity region 37 62 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
low complexity region 112 120 N/A INTRINSIC
low complexity region 236 257 N/A INTRINSIC
low complexity region 296 306 N/A INTRINSIC
low complexity region 307 324 N/A INTRINSIC
low complexity region 330 350 N/A INTRINSIC
coiled coil region 356 383 N/A INTRINSIC
ZnF_C2H2 389 413 1.05e1 SMART
SCOP:d1jvr__ 538 613 7e-5 SMART
low complexity region 628 640 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 90% (61/68)
MGI Phenotype FUNCTION: This gene encodes a member of the A-kinase anchoring protein (AKAP) family. These proteins are characterized by their ability to bind to the R subunit of protein kinase A (PKA) and anchor the protein at different subcellular locations. This protein has been shown to regulate apoptosis and to be involved in palatogenesis. Knockdown of this gene has been associated with altered histone modifications and reduced expression of developmental genes in mouse embryonic stem cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a gene trap insertion are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,231,404 probably null Het
2410089E03Rik A T 15: 8,218,464 K1499M probably damaging Het
Adam22 C A 5: 8,132,418 C514F probably damaging Het
Armcx2 A T X: 134,806,299 V195E probably benign Het
Atg7 T C 6: 114,697,047 S301P possibly damaging Het
Cc2d2a C A 5: 43,718,691 Y1003* probably null Het
Ccdc93 A G 1: 121,463,114 S272G probably benign Het
Ces1d C G 8: 93,175,086 L418F probably benign Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ehd4 T A 2: 120,136,953 D120V probably damaging Het
Eif4g3 T A 4: 138,096,900 V71E probably damaging Het
Exoc5 A G 14: 49,019,396 probably benign Het
Glud1 T A 14: 34,325,580 probably benign Het
Gm10985 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 3: 53,845,205 probably null Het
Gm11555 G T 11: 99,649,990 C64* probably null Het
Gm5468 A G 15: 25,414,475 probably benign Het
Gpatch2 T A 1: 187,322,294 L74Q probably damaging Het
Hnrnpa0 G A 13: 58,127,899 R139C probably damaging Het
Hrh1 A G 6: 114,480,919 Y387C probably damaging Het
Ldb3 A T 14: 34,567,483 D216E probably damaging Het
Lingo1 A T 9: 56,619,725 S533T probably benign Het
Lmtk2 T G 5: 144,166,427 probably benign Het
Map1s A G 8: 70,917,101 E939G possibly damaging Het
Mast1 G A 8: 84,918,731 T695I probably damaging Het
Mettl21e G A 1: 44,206,364 R241W probably benign Het
Mfsd4a G A 1: 132,046,353 T261I probably damaging Het
Mmel1 T C 4: 154,883,638 S144P probably benign Het
Myo16 A T 8: 10,442,239 H727L probably benign Het
Ncoa6 T C 2: 155,415,557 probably null Het
Nipa2 T C 7: 55,932,942 R352G probably damaging Het
Oaf C T 9: 43,222,758 R222Q probably benign Het
Olfr701 T A 7: 106,818,840 Y252* probably null Het
Pard3 T C 8: 127,409,686 S847P probably damaging Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Plcb1 A C 2: 135,325,671 I462L probably damaging Het
Prex2 T C 1: 11,160,192 V814A possibly damaging Het
Rasal3 G A 17: 32,393,548 R780W possibly damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Ryk A G 9: 102,891,228 E359G probably damaging Het
Sall2 C A 14: 52,313,994 L579F probably damaging Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Scg3 T C 9: 75,675,499 probably benign Het
Slc35f5 A G 1: 125,562,361 T65A probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Stat2 T A 10: 128,277,893 S180R probably benign Het
Stxbp2 A G 8: 3,634,079 T129A probably damaging Het
Tas1r3 A T 4: 155,861,353 C529S probably damaging Het
Tlr12 T A 4: 128,616,568 M630L probably benign Het
Tnfrsf10b T G 14: 69,773,456 D103E probably benign Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Tppp A G 13: 74,030,772 T111A probably benign Het
Trim12c T C 7: 104,348,337 Q4R probably benign Het
Ttbk2 T G 2: 120,740,019 S1149R probably damaging Het
Uncx T C 5: 139,547,365 L395P probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 A T 11: 85,007,055 Y1153* probably null Het
Vmn2r6 T C 3: 64,556,621 E264G probably damaging Het
Vmn2r77 T C 7: 86,811,842 F792S probably damaging Het
Vps13c A G 9: 67,884,726 I425V probably benign Het
Vstm4 C T 14: 32,863,755 A93V probably benign Het
Xrcc6 T A 15: 82,025,684 S97T probably benign Het
Zscan20 A G 4: 128,586,425 C758R probably damaging Het
Other mutations in Akap8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Akap8 APN 17 32317280 missense probably damaging 1.00
IGL01450:Akap8 APN 17 32315687 missense probably damaging 1.00
IGL02002:Akap8 APN 17 32309496 missense probably damaging 1.00
IGL02223:Akap8 APN 17 32316647 missense probably damaging 1.00
IGL02315:Akap8 APN 17 32305501 missense probably benign 0.01
IGL03404:Akap8 APN 17 32312276 splice site probably benign
BB006:Akap8 UTSW 17 32309445 missense probably damaging 1.00
BB016:Akap8 UTSW 17 32309445 missense probably damaging 1.00
R0310:Akap8 UTSW 17 32316260 missense possibly damaging 0.81
R0526:Akap8 UTSW 17 32317292 missense probably benign 0.28
R1795:Akap8 UTSW 17 32315477 missense probably damaging 1.00
R1992:Akap8 UTSW 17 32316612 missense probably damaging 0.99
R2571:Akap8 UTSW 17 32315455 missense probably damaging 1.00
R2918:Akap8 UTSW 17 32305648 missense probably benign 0.01
R3423:Akap8 UTSW 17 32316455 missense possibly damaging 0.61
R4077:Akap8 UTSW 17 32312298 missense probably damaging 1.00
R4078:Akap8 UTSW 17 32312298 missense probably damaging 1.00
R4379:Akap8 UTSW 17 32306560 missense probably damaging 0.99
R4756:Akap8 UTSW 17 32316210 missense probably damaging 0.98
R4819:Akap8 UTSW 17 32312305 missense probably damaging 1.00
R5091:Akap8 UTSW 17 32316234 missense probably benign 0.05
R5761:Akap8 UTSW 17 32317185 missense possibly damaging 0.56
R6896:Akap8 UTSW 17 32317331 missense probably benign 0.00
R7138:Akap8 UTSW 17 32316541 missense possibly damaging 0.86
R7350:Akap8 UTSW 17 32316575 missense possibly damaging 0.92
R7929:Akap8 UTSW 17 32309445 missense probably damaging 1.00
R8693:Akap8 UTSW 17 32310651 missense probably damaging 1.00
R8810:Akap8 UTSW 17 32306530 missense probably damaging 1.00
R9521:Akap8 UTSW 17 32311062 missense possibly damaging 0.89
X0020:Akap8 UTSW 17 32315750 missense probably benign 0.08
Z1176:Akap8 UTSW 17 32306549 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCAAACTCCCCTTCAGG -3'
(R):5'- TTTCATGGGAGAAGTCAGGCC -3'

Sequencing Primer
(F):5'- AGGTCAGCCTAGCTCTGATAC -3'
(R):5'- CCTGCCTGGGAGAGAAATATTATTG -3'
Posted On 2015-04-06