Incidental Mutation 'R3871:Igfn1'
ID 276550
Institutional Source Beutler Lab
Gene Symbol Igfn1
Ensembl Gene ENSMUSG00000051985
Gene Name immunoglobulin-like and fibronectin type III domain containing 1
Synonyms 9830123M21Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R3871 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 135881316-135934080 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 135896574 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 1331 (H1331N)
Ref Sequence ENSEMBL: ENSMUSP00000129680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166193]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000124134
SMART Domains Protein: ENSMUSP00000119230
Gene: ENSMUSG00000051985

DomainStartEndE-ValueType
IG 73 159 1.29e-6 SMART
IG_like 258 344 5.45e1 SMART
IG 354 435 1.79e0 SMART
IG 445 524 3.54e-4 SMART
IG 538 624 4.86e-2 SMART
FN3 627 711 3.99e-10 SMART
FN3 727 810 9.1e-14 SMART
FN3 828 911 1.5e-14 SMART
IG 938 1021 6.41e-2 SMART
FN3 1024 1106 3.2e-9 SMART
IGc2 1152 1219 4.89e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166193
AA Change: H1331N

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000129680
Gene: ENSMUSG00000051985
AA Change: H1331N

DomainStartEndE-ValueType
low complexity region 90 101 N/A INTRINSIC
IG 193 279 1.29e-6 SMART
PDB:2LHU|A 302 365 8e-7 PDB
IG_like 378 464 5.45e1 SMART
IG 474 555 1.79e0 SMART
low complexity region 724 739 N/A INTRINSIC
internal_repeat_2 838 1006 9.98e-5 PROSPERO
low complexity region 1067 1084 N/A INTRINSIC
internal_repeat_2 1812 1967 9.98e-5 PROSPERO
Pfam:I-set 2054 2139 6.2e-8 PFAM
IG 2153 2239 4.86e-2 SMART
FN3 2242 2326 3.99e-10 SMART
FN3 2342 2425 9.1e-14 SMART
FN3 2443 2526 1.5e-14 SMART
IG 2553 2636 6.41e-2 SMART
FN3 2639 2721 3.2e-9 SMART
IGc2 2767 2834 4.89e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 T A 19: 20,602,117 (GRCm39) Y225* probably null Het
Bard1 T C 1: 71,114,099 (GRCm39) K294R probably benign Het
Bcap29 A T 12: 31,667,080 (GRCm39) S194T probably benign Het
Ccdc40 G A 11: 119,155,107 (GRCm39) V1116M probably damaging Het
Cntnap5a A G 1: 115,987,979 (GRCm39) E170G probably damaging Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Cyp2c54 T C 19: 40,060,867 (GRCm39) D92G probably benign Het
Dpp6 T C 5: 27,674,463 (GRCm39) F197L probably benign Het
Filip1l G T 16: 57,333,649 (GRCm39) K147N probably damaging Het
Hrnr T A 3: 93,239,181 (GRCm39) S3140T unknown Het
Kalrn C T 16: 34,024,226 (GRCm39) probably null Het
Kmt2d TTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGC 15: 98,748,902 (GRCm39) probably benign Het
Mfng A G 15: 78,640,821 (GRCm39) L308P probably damaging Het
Nt5e C A 9: 88,246,746 (GRCm39) N327K probably benign Het
Or5m13 T G 2: 85,748,926 (GRCm39) probably null Het
Pgbd1 C T 13: 21,618,540 (GRCm39) R39H possibly damaging Het
Phactr4 T C 4: 132,104,560 (GRCm39) T256A probably benign Het
Rab24 T C 13: 55,468,992 (GRCm39) D63G probably damaging Het
Rubcnl C T 14: 75,278,356 (GRCm39) P380L probably benign Het
Satb2 A G 1: 56,930,379 (GRCm39) S215P probably damaging Het
Serpina3b A T 12: 104,105,047 (GRCm39) I408F probably damaging Het
Setx A G 2: 29,035,753 (GRCm39) D746G probably damaging Het
Sf3a2 A C 10: 80,640,527 (GRCm39) probably benign Het
Snx33 T C 9: 56,834,024 (GRCm39) N15S probably benign Het
Snx9 C T 17: 5,942,056 (GRCm39) P61L probably benign Het
Sult2a6 T C 7: 13,988,701 (GRCm39) K20E probably benign Het
Tas2r122 A G 6: 132,688,543 (GRCm39) S117P probably benign Het
Tmem26 G A 10: 68,614,562 (GRCm39) E326K probably benign Het
Tnpo2 T A 8: 85,781,380 (GRCm39) C789S probably null Het
Togaram1 A C 12: 65,049,419 (GRCm39) E1285D probably benign Het
Ubxn7 T A 16: 32,200,248 (GRCm39) S335T possibly damaging Het
Unc119b G A 5: 115,268,567 (GRCm39) T106M probably damaging Het
Usp14 A G 18: 10,002,370 (GRCm39) S314P possibly damaging Het
Usp32 T C 11: 84,971,982 (GRCm39) D129G probably null Het
Other mutations in Igfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Igfn1 APN 1 135,894,464 (GRCm39) missense probably damaging 1.00
IGL02299:Igfn1 APN 1 135,881,755 (GRCm39) utr 3 prime probably benign
Bounty UTSW 1 135,904,655 (GRCm39) critical splice donor site probably null
R2276_Igfn1_773 UTSW 1 135,892,479 (GRCm39) missense probably damaging 0.98
R4058_Igfn1_315 UTSW 1 135,897,494 (GRCm39) missense probably benign 0.07
R0144:Igfn1 UTSW 1 135,889,751 (GRCm39) missense probably damaging 0.99
R0190:Igfn1 UTSW 1 135,889,790 (GRCm39) missense probably damaging 1.00
R0350:Igfn1 UTSW 1 135,884,505 (GRCm39) nonsense probably null
R0413:Igfn1 UTSW 1 135,895,334 (GRCm39) missense probably benign 0.23
R0504:Igfn1 UTSW 1 135,896,267 (GRCm39) missense probably benign 0.00
R0606:Igfn1 UTSW 1 135,887,639 (GRCm39) missense probably damaging 1.00
R0681:Igfn1 UTSW 1 135,891,591 (GRCm39) missense possibly damaging 0.88
R0825:Igfn1 UTSW 1 135,890,864 (GRCm39) missense probably damaging 1.00
R0839:Igfn1 UTSW 1 135,882,418 (GRCm39) missense probably damaging 1.00
R1066:Igfn1 UTSW 1 135,898,463 (GRCm39) missense probably benign
R1078:Igfn1 UTSW 1 135,902,585 (GRCm39) missense probably damaging 1.00
R1224:Igfn1 UTSW 1 135,897,494 (GRCm39) missense probably benign 0.07
R1569:Igfn1 UTSW 1 135,896,771 (GRCm39) missense probably benign
R1626:Igfn1 UTSW 1 135,896,705 (GRCm39) missense probably benign 0.29
R1663:Igfn1 UTSW 1 135,896,046 (GRCm39) missense probably benign 0.15
R1677:Igfn1 UTSW 1 135,898,839 (GRCm39) missense probably damaging 0.99
R1709:Igfn1 UTSW 1 135,883,311 (GRCm39) missense probably benign 0.24
R1728:Igfn1 UTSW 1 135,926,421 (GRCm39) missense unknown
R1728:Igfn1 UTSW 1 135,926,363 (GRCm39) missense probably benign
R1728:Igfn1 UTSW 1 135,910,213 (GRCm39) missense probably benign
R1728:Igfn1 UTSW 1 135,907,653 (GRCm39) missense probably benign 0.00
R1728:Igfn1 UTSW 1 135,899,865 (GRCm39) missense probably benign
R1728:Igfn1 UTSW 1 135,898,149 (GRCm39) missense probably benign
R1728:Igfn1 UTSW 1 135,895,937 (GRCm39) missense probably benign
R1728:Igfn1 UTSW 1 135,887,666 (GRCm39) missense probably damaging 1.00
R1729:Igfn1 UTSW 1 135,910,213 (GRCm39) missense probably benign
R1729:Igfn1 UTSW 1 135,907,653 (GRCm39) missense probably benign 0.00
R1729:Igfn1 UTSW 1 135,899,865 (GRCm39) missense probably benign
R1729:Igfn1 UTSW 1 135,898,149 (GRCm39) missense probably benign
R1729:Igfn1 UTSW 1 135,895,937 (GRCm39) missense probably benign
R1729:Igfn1 UTSW 1 135,887,666 (GRCm39) missense probably damaging 1.00
R1729:Igfn1 UTSW 1 135,926,421 (GRCm39) missense unknown
R1729:Igfn1 UTSW 1 135,926,363 (GRCm39) missense probably benign
R1730:Igfn1 UTSW 1 135,887,666 (GRCm39) missense probably damaging 1.00
R1730:Igfn1 UTSW 1 135,895,937 (GRCm39) missense probably benign
R1730:Igfn1 UTSW 1 135,898,149 (GRCm39) missense probably benign
R1730:Igfn1 UTSW 1 135,899,865 (GRCm39) missense probably benign
R1730:Igfn1 UTSW 1 135,907,653 (GRCm39) missense probably benign 0.00
R1730:Igfn1 UTSW 1 135,910,213 (GRCm39) missense probably benign
R1730:Igfn1 UTSW 1 135,926,363 (GRCm39) missense probably benign
R1730:Igfn1 UTSW 1 135,926,421 (GRCm39) missense unknown
R1739:Igfn1 UTSW 1 135,899,865 (GRCm39) missense probably benign
R1739:Igfn1 UTSW 1 135,907,653 (GRCm39) missense probably benign 0.00
R1739:Igfn1 UTSW 1 135,910,213 (GRCm39) missense probably benign
R1739:Igfn1 UTSW 1 135,926,363 (GRCm39) missense probably benign
R1739:Igfn1 UTSW 1 135,898,149 (GRCm39) missense probably benign
R1739:Igfn1 UTSW 1 135,895,937 (GRCm39) missense probably benign
R1739:Igfn1 UTSW 1 135,887,666 (GRCm39) missense probably damaging 1.00
R1739:Igfn1 UTSW 1 135,926,421 (GRCm39) missense unknown
R1746:Igfn1 UTSW 1 135,897,561 (GRCm39) missense possibly damaging 0.88
R1762:Igfn1 UTSW 1 135,926,363 (GRCm39) missense probably benign
R1762:Igfn1 UTSW 1 135,910,213 (GRCm39) missense probably benign
R1762:Igfn1 UTSW 1 135,907,653 (GRCm39) missense probably benign 0.00
R1762:Igfn1 UTSW 1 135,899,865 (GRCm39) missense probably benign
R1762:Igfn1 UTSW 1 135,898,149 (GRCm39) missense probably benign
R1762:Igfn1 UTSW 1 135,895,937 (GRCm39) missense probably benign
R1762:Igfn1 UTSW 1 135,887,666 (GRCm39) missense probably damaging 1.00
R1762:Igfn1 UTSW 1 135,926,421 (GRCm39) missense unknown
R1783:Igfn1 UTSW 1 135,910,213 (GRCm39) missense probably benign
R1783:Igfn1 UTSW 1 135,907,653 (GRCm39) missense probably benign 0.00
R1783:Igfn1 UTSW 1 135,899,865 (GRCm39) missense probably benign
R1783:Igfn1 UTSW 1 135,898,149 (GRCm39) missense probably benign
R1783:Igfn1 UTSW 1 135,895,937 (GRCm39) missense probably benign
R1783:Igfn1 UTSW 1 135,887,666 (GRCm39) missense probably damaging 1.00
R1783:Igfn1 UTSW 1 135,926,421 (GRCm39) missense unknown
R1783:Igfn1 UTSW 1 135,926,363 (GRCm39) missense probably benign
R1784:Igfn1 UTSW 1 135,926,421 (GRCm39) missense unknown
R1784:Igfn1 UTSW 1 135,926,363 (GRCm39) missense probably benign
R1784:Igfn1 UTSW 1 135,910,213 (GRCm39) missense probably benign
R1784:Igfn1 UTSW 1 135,907,653 (GRCm39) missense probably benign 0.00
R1784:Igfn1 UTSW 1 135,899,865 (GRCm39) missense probably benign
R1784:Igfn1 UTSW 1 135,898,149 (GRCm39) missense probably benign
R1784:Igfn1 UTSW 1 135,895,937 (GRCm39) missense probably benign
R1784:Igfn1 UTSW 1 135,887,666 (GRCm39) missense probably damaging 1.00
R1785:Igfn1 UTSW 1 135,926,421 (GRCm39) missense unknown
R1785:Igfn1 UTSW 1 135,926,363 (GRCm39) missense probably benign
R1785:Igfn1 UTSW 1 135,910,213 (GRCm39) missense probably benign
R1785:Igfn1 UTSW 1 135,907,653 (GRCm39) missense probably benign 0.00
R1785:Igfn1 UTSW 1 135,899,865 (GRCm39) missense probably benign
R1785:Igfn1 UTSW 1 135,898,149 (GRCm39) missense probably benign
R1785:Igfn1 UTSW 1 135,895,937 (GRCm39) missense probably benign
R1785:Igfn1 UTSW 1 135,887,666 (GRCm39) missense probably damaging 1.00
R1847:Igfn1 UTSW 1 135,897,126 (GRCm39) missense probably benign
R1866:Igfn1 UTSW 1 135,902,606 (GRCm39) splice site probably null
R1921:Igfn1 UTSW 1 135,893,801 (GRCm39) critical splice donor site probably null
R1984:Igfn1 UTSW 1 135,889,782 (GRCm39) missense probably benign 0.39
R2049:Igfn1 UTSW 1 135,902,590 (GRCm39) splice site probably benign
R2049:Igfn1 UTSW 1 135,898,376 (GRCm39) missense probably benign
R2098:Igfn1 UTSW 1 135,906,043 (GRCm39) missense probably damaging 1.00
R2130:Igfn1 UTSW 1 135,902,590 (GRCm39) splice site probably benign
R2141:Igfn1 UTSW 1 135,902,590 (GRCm39) splice site probably benign
R2276:Igfn1 UTSW 1 135,892,479 (GRCm39) missense probably damaging 0.98
R2425:Igfn1 UTSW 1 135,890,840 (GRCm39) missense probably damaging 1.00
R2483:Igfn1 UTSW 1 135,897,275 (GRCm39) missense probably benign
R2504:Igfn1 UTSW 1 135,897,054 (GRCm39) missense probably benign 0.07
R3109:Igfn1 UTSW 1 135,925,586 (GRCm39) missense probably benign 0.12
R3421:Igfn1 UTSW 1 135,904,655 (GRCm39) critical splice donor site probably null
R3423:Igfn1 UTSW 1 135,926,379 (GRCm39) missense probably benign 0.01
R3705:Igfn1 UTSW 1 135,896,147 (GRCm39) missense probably benign
R3875:Igfn1 UTSW 1 135,882,352 (GRCm39) missense probably damaging 1.00
R3953:Igfn1 UTSW 1 135,894,918 (GRCm39) missense possibly damaging 0.61
R3955:Igfn1 UTSW 1 135,894,918 (GRCm39) missense possibly damaging 0.61
R3957:Igfn1 UTSW 1 135,894,918 (GRCm39) missense possibly damaging 0.61
R3965:Igfn1 UTSW 1 135,895,557 (GRCm39) missense probably benign
R4006:Igfn1 UTSW 1 135,910,100 (GRCm39) splice site probably null
R4058:Igfn1 UTSW 1 135,897,494 (GRCm39) missense probably benign 0.07
R4059:Igfn1 UTSW 1 135,897,494 (GRCm39) missense probably benign 0.07
R4370:Igfn1 UTSW 1 135,895,844 (GRCm39) missense probably benign 0.00
R4380:Igfn1 UTSW 1 135,895,509 (GRCm39) missense probably benign 0.00
R4495:Igfn1 UTSW 1 135,897,416 (GRCm39) missense possibly damaging 0.79
R4628:Igfn1 UTSW 1 135,887,468 (GRCm39) missense possibly damaging 0.47
R4672:Igfn1 UTSW 1 135,893,107 (GRCm39) missense possibly damaging 0.72
R4682:Igfn1 UTSW 1 135,926,363 (GRCm39) missense probably benign
R4702:Igfn1 UTSW 1 135,894,947 (GRCm39) missense possibly damaging 0.71
R4744:Igfn1 UTSW 1 135,910,196 (GRCm39) missense probably benign 0.07
R4777:Igfn1 UTSW 1 135,882,600 (GRCm39) missense probably benign
R4806:Igfn1 UTSW 1 135,895,095 (GRCm39) missense probably benign 0.01
R4840:Igfn1 UTSW 1 135,895,778 (GRCm39) missense probably benign 0.00
R4894:Igfn1 UTSW 1 135,882,520 (GRCm39) missense probably damaging 1.00
R4998:Igfn1 UTSW 1 135,882,404 (GRCm39) missense probably damaging 1.00
R5092:Igfn1 UTSW 1 135,892,564 (GRCm39) missense probably benign
R5108:Igfn1 UTSW 1 135,910,179 (GRCm39) missense probably benign
R5120:Igfn1 UTSW 1 135,901,240 (GRCm39) missense possibly damaging 0.93
R5127:Igfn1 UTSW 1 135,887,634 (GRCm39) missense probably damaging 1.00
R5231:Igfn1 UTSW 1 135,894,474 (GRCm39) missense probably benign 0.26
R5286:Igfn1 UTSW 1 135,895,599 (GRCm39) missense probably benign 0.10
R5307:Igfn1 UTSW 1 135,892,676 (GRCm39) missense probably damaging 1.00
R5380:Igfn1 UTSW 1 135,893,825 (GRCm39) missense probably damaging 1.00
R5553:Igfn1 UTSW 1 135,895,622 (GRCm39) missense probably damaging 1.00
R5660:Igfn1 UTSW 1 135,898,152 (GRCm39) missense probably benign 0.01
R5779:Igfn1 UTSW 1 135,894,578 (GRCm39) missense probably benign 0.16
R5818:Igfn1 UTSW 1 135,893,864 (GRCm39) missense possibly damaging 0.72
R5832:Igfn1 UTSW 1 135,902,533 (GRCm39) missense probably damaging 0.96
R5933:Igfn1 UTSW 1 135,898,341 (GRCm39) nonsense probably null
R5966:Igfn1 UTSW 1 135,893,152 (GRCm39) missense probably damaging 1.00
R6116:Igfn1 UTSW 1 135,898,205 (GRCm39) missense probably benign 0.00
R6297:Igfn1 UTSW 1 135,892,399 (GRCm39) critical splice donor site probably null
R6652:Igfn1 UTSW 1 135,891,609 (GRCm39) missense probably damaging 1.00
R6737:Igfn1 UTSW 1 135,897,605 (GRCm39) missense probably benign
R6816:Igfn1 UTSW 1 135,887,466 (GRCm39) missense probably benign 0.02
R6886:Igfn1 UTSW 1 135,901,198 (GRCm39) missense probably damaging 1.00
R6888:Igfn1 UTSW 1 135,910,218 (GRCm39) missense probably benign 0.33
R6975:Igfn1 UTSW 1 135,896,183 (GRCm39) missense probably damaging 0.96
R7105:Igfn1 UTSW 1 135,911,956 (GRCm39) missense probably benign 0.11
R7114:Igfn1 UTSW 1 135,894,519 (GRCm39) missense probably benign 0.01
R7233:Igfn1 UTSW 1 135,897,873 (GRCm39) missense probably benign 0.41
R7276:Igfn1 UTSW 1 135,926,376 (GRCm39) missense possibly damaging 0.85
R7354:Igfn1 UTSW 1 135,903,770 (GRCm39) missense possibly damaging 0.72
R7358:Igfn1 UTSW 1 135,891,738 (GRCm39) missense probably damaging 1.00
R7380:Igfn1 UTSW 1 135,889,746 (GRCm39) missense probably damaging 1.00
R7389:Igfn1 UTSW 1 135,894,785 (GRCm39) missense probably benign 0.00
R7513:Igfn1 UTSW 1 135,887,705 (GRCm39) missense probably damaging 1.00
R7718:Igfn1 UTSW 1 135,896,774 (GRCm39) missense probably benign
R7769:Igfn1 UTSW 1 135,910,143 (GRCm39) missense possibly damaging 0.85
R7810:Igfn1 UTSW 1 135,902,527 (GRCm39) missense probably damaging 0.98
R7917:Igfn1 UTSW 1 135,899,706 (GRCm39) missense probably damaging 0.99
R7952:Igfn1 UTSW 1 135,891,693 (GRCm39) missense probably damaging 0.99
R8041:Igfn1 UTSW 1 135,895,797 (GRCm39) nonsense probably null
R8233:Igfn1 UTSW 1 135,895,782 (GRCm39) missense probably benign 0.00
R8354:Igfn1 UTSW 1 135,887,619 (GRCm39) missense possibly damaging 0.61
R8363:Igfn1 UTSW 1 135,891,625 (GRCm39) missense probably benign 0.01
R8428:Igfn1 UTSW 1 135,895,520 (GRCm39) missense probably damaging 1.00
R8731:Igfn1 UTSW 1 135,925,574 (GRCm39) missense probably benign 0.02
R8756:Igfn1 UTSW 1 135,895,698 (GRCm39) missense probably benign 0.10
R8797:Igfn1 UTSW 1 135,902,573 (GRCm39) missense possibly damaging 0.93
R8913:Igfn1 UTSW 1 135,891,579 (GRCm39) missense possibly damaging 0.90
R8927:Igfn1 UTSW 1 135,905,984 (GRCm39) missense probably damaging 1.00
R8928:Igfn1 UTSW 1 135,905,984 (GRCm39) missense probably damaging 1.00
R9087:Igfn1 UTSW 1 135,902,606 (GRCm39) splice site probably null
R9109:Igfn1 UTSW 1 135,926,327 (GRCm39) missense probably benign 0.26
R9113:Igfn1 UTSW 1 135,883,328 (GRCm39) missense probably damaging 1.00
R9117:Igfn1 UTSW 1 135,902,528 (GRCm39) missense probably benign 0.03
R9205:Igfn1 UTSW 1 135,903,695 (GRCm39) missense probably damaging 0.96
R9251:Igfn1 UTSW 1 135,894,409 (GRCm39) splice site probably benign
R9260:Igfn1 UTSW 1 135,907,694 (GRCm39) missense probably benign 0.45
R9275:Igfn1 UTSW 1 135,901,185 (GRCm39) missense probably damaging 0.96
R9277:Igfn1 UTSW 1 135,887,520 (GRCm39) missense probably damaging 0.98
R9278:Igfn1 UTSW 1 135,901,185 (GRCm39) missense probably damaging 0.96
R9287:Igfn1 UTSW 1 135,925,544 (GRCm39) missense probably benign 0.33
R9298:Igfn1 UTSW 1 135,926,327 (GRCm39) missense probably benign 0.26
R9356:Igfn1 UTSW 1 135,899,825 (GRCm39) nonsense probably null
R9371:Igfn1 UTSW 1 135,906,001 (GRCm39) missense probably damaging 1.00
R9532:Igfn1 UTSW 1 135,897,229 (GRCm39) missense possibly damaging 0.61
R9653:Igfn1 UTSW 1 135,883,323 (GRCm39) nonsense probably null
R9666:Igfn1 UTSW 1 135,897,692 (GRCm39) missense possibly damaging 0.65
R9741:Igfn1 UTSW 1 135,895,383 (GRCm39) missense probably benign 0.00
R9748:Igfn1 UTSW 1 135,926,336 (GRCm39) missense possibly damaging 0.89
R9796:Igfn1 UTSW 1 135,897,611 (GRCm39) missense probably benign 0.26
Z1176:Igfn1 UTSW 1 135,899,738 (GRCm39) missense probably damaging 0.99
Z1177:Igfn1 UTSW 1 135,897,305 (GRCm39) missense probably benign 0.26
Z1177:Igfn1 UTSW 1 135,883,547 (GRCm39) missense probably damaging 1.00
Z1177:Igfn1 UTSW 1 135,910,164 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TAAATGCCACCTCACCATCTGG -3'
(R):5'- GAGTTCTTGGGGTCACACTG -3'

Sequencing Primer
(F):5'- CCATCTGGTCCTGTTCTTTCAG -3'
(R):5'- CACACTGGAGATTATGAGGACTTCC -3'
Posted On 2015-04-06