Incidental Mutation 'R3871:Olfr1025-ps1'
ID276552
Institutional Source Beutler Lab
Gene Symbol Olfr1025-ps1
Ensembl Gene ENSMUSG00000058884
Gene Nameolfactory receptor 1025, pseudogene 1
SynonymsMOR196-6_p, GA_x6K02T2Q125-47397266-47398205, MOR196-5P
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R3871 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85915193-85921381 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 85918582 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056718] [ENSMUST00000188749] [ENSMUST00000213474] [ENSMUST00000217615] [ENSMUST00000219615]
Predicted Effect probably null
Transcript: ENSMUST00000056718
SMART Domains Protein: ENSMUSP00000049887
Gene: ENSMUSG00000042863

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 6.1e-58 PFAM
Pfam:7tm_1 41 290 9e-25 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000076311
Gene: ENSMUSG00000058884
AA Change: I219S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.5e-57 PFAM
Pfam:7tm_1 41 290 2.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188749
AA Change: I219S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000139860
Gene: ENSMUSG00000058884
AA Change: I219S

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
Pfam:7tm_1 41 290 5.7e-30 PFAM
Pfam:7tm_4 139 283 7.8e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213474
AA Change: I219S

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably null
Transcript: ENSMUST00000217615
Predicted Effect probably null
Transcript: ENSMUST00000219615
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 T A 19: 20,624,753 Y225* probably null Het
Bard1 T C 1: 71,074,940 K294R probably benign Het
Bcap29 A T 12: 31,617,081 S194T probably benign Het
Ccdc40 G A 11: 119,264,281 V1116M probably damaging Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp2c54 T C 19: 40,072,423 D92G probably benign Het
Dpp6 T C 5: 27,469,465 F197L probably benign Het
Filip1l G T 16: 57,513,286 K147N probably damaging Het
Hrnr T A 3: 93,331,874 S3140T unknown Het
Igfn1 G T 1: 135,968,836 H1331N probably benign Het
Kalrn C T 16: 34,203,856 probably null Het
Kmt2d TTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGC 15: 98,851,021 probably benign Het
Mfng A G 15: 78,756,621 L308P probably damaging Het
Nt5e C A 9: 88,364,693 N327K probably benign Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Phactr4 T C 4: 132,377,249 T256A probably benign Het
Rab24 T C 13: 55,321,179 D63G probably damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Serpina3b A T 12: 104,138,788 I408F probably damaging Het
Setx A G 2: 29,145,741 D746G probably damaging Het
Sf3a2 A C 10: 80,804,693 probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Snx9 C T 17: 5,891,781 P61L probably benign Het
Sult2a6 T C 7: 14,254,776 K20E probably benign Het
Tas2r122 A G 6: 132,711,580 S117P probably benign Het
Tmem26 G A 10: 68,778,732 E326K probably benign Het
Tnpo2 T A 8: 85,054,751 C789S probably null Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Ubxn7 T A 16: 32,381,430 S335T possibly damaging Het
Unc119b G A 5: 115,130,508 T106M probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 T C 11: 85,081,156 D129G probably null Het
Other mutations in Olfr1025-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01660:Olfr1025-ps1 APN 2 85918564 missense probably benign 0.25
IGL02881:Olfr1025-ps1 APN 2 85918116 missense probably benign 0.00
R0097:Olfr1025-ps1 UTSW 2 85918840 missense probably benign 0.00
R0097:Olfr1025-ps1 UTSW 2 85918840 missense probably benign 0.00
R0324:Olfr1025-ps1 UTSW 2 85917951 missense probably benign 0.22
R0392:Olfr1025-ps1 UTSW 2 85918762 missense possibly damaging 0.81
R0765:Olfr1025-ps1 UTSW 2 85918705 missense probably damaging 0.99
R1199:Olfr1025-ps1 UTSW 2 85918035 missense probably benign 0.00
R1894:Olfr1025-ps1 UTSW 2 85918255 missense probably benign 0.28
R2027:Olfr1025-ps1 UTSW 2 85918770 missense probably damaging 0.99
R2141:Olfr1025-ps1 UTSW 2 85918827 missense probably null
R4837:Olfr1025-ps1 UTSW 2 85918404 missense probably benign 0.00
R4945:Olfr1025-ps1 UTSW 2 85918573 missense possibly damaging 0.81
R5056:Olfr1025-ps1 UTSW 2 85918136 missense probably damaging 1.00
R5441:Olfr1025-ps1 UTSW 2 85918590 missense probably benign 0.01
R5960:Olfr1025-ps1 UTSW 2 85918725 missense probably benign 0.07
R6807:Olfr1025-ps1 UTSW 2 85918038 missense possibly damaging 0.48
R7320:Olfr1025-ps1 UTSW 2 85918374 missense probably benign 0.00
V1662:Olfr1025-ps1 UTSW 2 85918594 missense probably benign 0.10
Z1176:Olfr1025-ps1 UTSW 2 85918501 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGCACAGACCATCCTGATG -3'
(R):5'- TATAGATCAAGGGGTTCAACATCGG -3'

Sequencing Primer
(F):5'- ACAGACCATCCTGATGCTTCG -3'
(R):5'- GTTCAACATCGGGCTTACAAAG -3'
Posted On2015-04-06