Incidental Mutation 'R3871:Dpp6'
ID276558
Institutional Source Beutler Lab
Gene Symbol Dpp6
Ensembl Gene ENSMUSG00000061576
Gene Namedipeptidylpeptidase 6
SynonymsRw, LOC384168, Peplb, Dpp-6, B930011P16Rik, In(5)6H-p
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R3871 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location26817203-27727505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27469465 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 197 (F197L)
Ref Sequence ENSEMBL: ENSMUSP00000113441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071500] [ENSMUST00000101471] [ENSMUST00000120555] [ENSMUST00000122171]
Predicted Effect probably benign
Transcript: ENSMUST00000071500
AA Change: F142L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000071435
Gene: ENSMUSG00000061576
AA Change: F142L

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
Pfam:DPPIV_N 134 500 7.2e-114 PFAM
Pfam:PD40 365 402 1.1e-5 PFAM
Pfam:Peptidase_S9 579 789 2.9e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101471
AA Change: F141L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000099012
Gene: ENSMUSG00000061576
AA Change: F141L

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
Pfam:DPPIV_N 133 499 2.6e-114 PFAM
Pfam:PD40 364 401 9.3e-6 PFAM
Pfam:Peptidase_S9 578 788 1.9e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120555
AA Change: F139L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113849
Gene: ENSMUSG00000061576
AA Change: F139L

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
Pfam:DPPIV_N 131 497 2.6e-114 PFAM
Pfam:PD40 362 399 9.2e-6 PFAM
Pfam:Peptidase_S9 576 786 1.9e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122171
AA Change: F197L

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113441
Gene: ENSMUSG00000061576
AA Change: F197L

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
transmembrane domain 90 112 N/A INTRINSIC
Pfam:DPPIV_N 189 555 6.4e-113 PFAM
Pfam:PD40 425 457 1.1e-4 PFAM
Pfam:Peptidase_S9 634 844 4.3e-40 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the peptidase S9B family of serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Variations in this gene may be associated with susceptibility to amyotrophic lateral sclerosis and with idiopathic ventricular fibrillation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit loss of A-type K+ current gradients in distal dendrites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 T A 19: 20,624,753 Y225* probably null Het
Bard1 T C 1: 71,074,940 K294R probably benign Het
Bcap29 A T 12: 31,617,081 S194T probably benign Het
Ccdc40 G A 11: 119,264,281 V1116M probably damaging Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp2c54 T C 19: 40,072,423 D92G probably benign Het
Filip1l G T 16: 57,513,286 K147N probably damaging Het
Hrnr T A 3: 93,331,874 S3140T unknown Het
Igfn1 G T 1: 135,968,836 H1331N probably benign Het
Kalrn C T 16: 34,203,856 probably null Het
Kmt2d TTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGC 15: 98,851,021 probably benign Het
Mfng A G 15: 78,756,621 L308P probably damaging Het
Nt5e C A 9: 88,364,693 N327K probably benign Het
Olfr1025-ps1 T G 2: 85,918,582 probably null Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Phactr4 T C 4: 132,377,249 T256A probably benign Het
Rab24 T C 13: 55,321,179 D63G probably damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Serpina3b A T 12: 104,138,788 I408F probably damaging Het
Setx A G 2: 29,145,741 D746G probably damaging Het
Sf3a2 A C 10: 80,804,693 probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Snx9 C T 17: 5,891,781 P61L probably benign Het
Sult2a6 T C 7: 14,254,776 K20E probably benign Het
Tas2r122 A G 6: 132,711,580 S117P probably benign Het
Tmem26 G A 10: 68,778,732 E326K probably benign Het
Tnpo2 T A 8: 85,054,751 C789S probably null Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Ubxn7 T A 16: 32,381,430 S335T possibly damaging Het
Unc119b G A 5: 115,130,508 T106M probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 T C 11: 85,081,156 D129G probably null Het
Other mutations in Dpp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Dpp6 APN 5 27723443 missense probably damaging 1.00
IGL01137:Dpp6 APN 5 27714488 missense probably damaging 1.00
IGL01386:Dpp6 APN 5 27664762 critical splice donor site probably null
IGL01409:Dpp6 APN 5 27557601 missense probably damaging 1.00
IGL01721:Dpp6 APN 5 27631520 missense probably damaging 1.00
IGL02149:Dpp6 APN 5 27538024 missense probably benign 0.00
IGL02174:Dpp6 APN 5 27721087 nonsense probably null
IGL02176:Dpp6 APN 5 27723577 missense probably damaging 0.98
IGL02326:Dpp6 APN 5 27664757 missense probably damaging 1.00
IGL02336:Dpp6 APN 5 27469411 missense probably benign 0.04
IGL02339:Dpp6 APN 5 27652230 missense probably damaging 0.97
IGL02402:Dpp6 APN 5 27634543 missense probably damaging 1.00
IGL02884:Dpp6 APN 5 27634556 missense possibly damaging 0.88
IGL02885:Dpp6 APN 5 27718473 missense probably damaging 1.00
IGL02938:Dpp6 APN 5 27723367 splice site probably benign
IGL03083:Dpp6 APN 5 27709550 critical splice donor site probably null
I0000:Dpp6 UTSW 5 27398922 missense probably benign 0.02
IGL03052:Dpp6 UTSW 5 27709508 missense probably benign 0.03
PIT4431001:Dpp6 UTSW 5 27631498 missense probably benign 0.03
R0060:Dpp6 UTSW 5 27598819 missense probably damaging 1.00
R0360:Dpp6 UTSW 5 27652269 missense probably damaging 1.00
R0486:Dpp6 UTSW 5 27661642 missense probably benign 0.39
R0501:Dpp6 UTSW 5 27725606 missense probably damaging 1.00
R1028:Dpp6 UTSW 5 27666427 missense probably benign 0.01
R1164:Dpp6 UTSW 5 27721105 missense probably benign 0.02
R1177:Dpp6 UTSW 5 27663473 missense possibly damaging 0.94
R1993:Dpp6 UTSW 5 27399006 missense probably benign 0.00
R2024:Dpp6 UTSW 5 27709459 missense possibly damaging 0.67
R2100:Dpp6 UTSW 5 27664744 missense probably damaging 0.96
R2329:Dpp6 UTSW 5 27451288 splice site probably null
R3619:Dpp6 UTSW 5 27721120 missense possibly damaging 0.74
R3872:Dpp6 UTSW 5 27721058 missense probably damaging 1.00
R4114:Dpp6 UTSW 5 27469487 critical splice donor site probably null
R4403:Dpp6 UTSW 5 27718462 missense probably damaging 1.00
R4599:Dpp6 UTSW 5 27634548 missense probably damaging 1.00
R4736:Dpp6 UTSW 5 27712659 missense probably damaging 1.00
R4929:Dpp6 UTSW 5 27049787 missense probably benign 0.25
R4967:Dpp6 UTSW 5 27666511 missense probably damaging 1.00
R5162:Dpp6 UTSW 5 27399015 unclassified probably benign
R5270:Dpp6 UTSW 5 27634534 missense probably damaging 0.98
R5334:Dpp6 UTSW 5 27709540 missense probably benign 0.30
R5437:Dpp6 UTSW 5 27663501 nonsense probably null
R5663:Dpp6 UTSW 5 27049622 missense possibly damaging 0.84
R6023:Dpp6 UTSW 5 27723547 missense probably damaging 0.96
R6244:Dpp6 UTSW 5 27049628 missense probably damaging 0.99
R6312:Dpp6 UTSW 5 27725671 missense possibly damaging 0.84
R6442:Dpp6 UTSW 5 27718509 critical splice donor site probably null
R6942:Dpp6 UTSW 5 27469459 missense possibly damaging 0.79
R6956:Dpp6 UTSW 5 27598821 missense probably damaging 1.00
R7210:Dpp6 UTSW 5 27598803 missense probably damaging 0.99
R7342:Dpp6 UTSW 5 27714554 missense probably benign
R7702:Dpp6 UTSW 5 27652276 missense probably benign 0.00
R7727:Dpp6 UTSW 5 27451244 missense probably benign 0.30
R7899:Dpp6 UTSW 5 27721079 missense probably benign 0.03
R7966:Dpp6 UTSW 5 27723372 missense probably benign 0.06
R8015:Dpp6 UTSW 5 26817810 start gained probably benign
R8084:Dpp6 UTSW 5 27631399 missense probably benign 0.32
R8178:Dpp6 UTSW 5 27598817 missense probably damaging 1.00
R8384:Dpp6 UTSW 5 27718474 missense probably benign 0.18
Z1176:Dpp6 UTSW 5 27398998 missense probably damaging 1.00
Z1177:Dpp6 UTSW 5 27712642 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCATACTTAATTTTGCTGGTTCAC -3'
(R):5'- AGGAGCCATTGTGTTTCCTACC -3'

Sequencing Primer
(F):5'- AATTTTGCTGGTTCACTGTTTTAC -3'
(R):5'- ATTGTGTTTCCTACCAAGAAAAATTG -3'
Posted On2015-04-06