Incidental Mutation 'R3871:Sult2a6'
ID276561
Institutional Source Beutler Lab
Gene Symbol Sult2a6
Ensembl Gene ENSMUSG00000070810
Gene Namesulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 6
SynonymsGm6957
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R3871 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location14222403-14254870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14254776 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 20 (K20E)
Ref Sequence ENSEMBL: ENSMUSP00000138842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076576] [ENSMUST00000184731]
Predicted Effect probably benign
Transcript: ENSMUST00000076576
AA Change: K20E

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000075884
Gene: ENSMUSG00000070810
AA Change: K20E

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 34 278 1.2e-81 PFAM
Pfam:Sulfotransfer_3 35 205 2.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184731
AA Change: K20E

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138842
Gene: ENSMUSG00000070810
AA Change: K20E

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 34 116 4.7e-20 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This is one of seven sulfotransferase family 2A genes in a chromosome 7 A1 cluster. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 T A 19: 20,624,753 Y225* probably null Het
Bard1 T C 1: 71,074,940 K294R probably benign Het
Bcap29 A T 12: 31,617,081 S194T probably benign Het
Ccdc40 G A 11: 119,264,281 V1116M probably damaging Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp2c54 T C 19: 40,072,423 D92G probably benign Het
Dpp6 T C 5: 27,469,465 F197L probably benign Het
Filip1l G T 16: 57,513,286 K147N probably damaging Het
Hrnr T A 3: 93,331,874 S3140T unknown Het
Igfn1 G T 1: 135,968,836 H1331N probably benign Het
Kalrn C T 16: 34,203,856 probably null Het
Kmt2d TTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGC 15: 98,851,021 probably benign Het
Mfng A G 15: 78,756,621 L308P probably damaging Het
Nt5e C A 9: 88,364,693 N327K probably benign Het
Olfr1025-ps1 T G 2: 85,918,582 probably null Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Phactr4 T C 4: 132,377,249 T256A probably benign Het
Rab24 T C 13: 55,321,179 D63G probably damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Serpina3b A T 12: 104,138,788 I408F probably damaging Het
Setx A G 2: 29,145,741 D746G probably damaging Het
Sf3a2 A C 10: 80,804,693 probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Snx9 C T 17: 5,891,781 P61L probably benign Het
Tas2r122 A G 6: 132,711,580 S117P probably benign Het
Tmem26 G A 10: 68,778,732 E326K probably benign Het
Tnpo2 T A 8: 85,054,751 C789S probably null Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Ubxn7 T A 16: 32,381,430 S335T possibly damaging Het
Unc119b G A 5: 115,130,508 T106M probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 T C 11: 85,081,156 D129G probably null Het
Other mutations in Sult2a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Sult2a6 APN 7 14254709 missense probably damaging 1.00
IGL01977:Sult2a6 APN 7 14253486 missense probably benign 0.00
IGL02524:Sult2a6 APN 7 14236686 missense possibly damaging 0.80
IGL03209:Sult2a6 APN 7 14225972 missense probably benign 0.36
IGL03379:Sult2a6 APN 7 14222586 missense probably benign 0.01
R1840:Sult2a6 UTSW 7 14254829 missense probably benign 0.03
R1893:Sult2a6 UTSW 7 14225889 missense probably benign 0.00
R2037:Sult2a6 UTSW 7 14254709 missense probably damaging 0.99
R2331:Sult2a6 UTSW 7 14225870 missense possibly damaging 0.94
R3921:Sult2a6 UTSW 7 14254743 missense possibly damaging 0.83
R5599:Sult2a6 UTSW 7 14254704 nonsense probably null
R5761:Sult2a6 UTSW 7 14250358 missense probably damaging 0.97
R6744:Sult2a6 UTSW 7 14222545 missense probably damaging 1.00
R6956:Sult2a6 UTSW 7 14254823 missense possibly damaging 0.50
R7152:Sult2a6 UTSW 7 14222520 missense probably benign 0.36
R7869:Sult2a6 UTSW 7 14254812 missense not run
R7990:Sult2a6 UTSW 7 14225870 missense possibly damaging 0.94
R8347:Sult2a6 UTSW 7 14225958 missense probably benign 0.15
R8369:Sult2a6 UTSW 7 14253402 critical splice donor site probably null
R8391:Sult2a6 UTSW 7 14222591 critical splice acceptor site probably null
R8414:Sult2a6 UTSW 7 14250432 missense probably damaging 1.00
Z1088:Sult2a6 UTSW 7 14225894 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGGTGCCATAGATGATCAC -3'
(R):5'- TCCTATCAGTAGCTAGTTTCACAAC -3'

Sequencing Primer
(F):5'- GTGGTGCCATAGATGATCACCTTATC -3'
(R):5'- GCAATATGCTGAACTGGTG -3'
Posted On2015-04-06