Mutagenetix > Incidental Mutations

Incidental Mutation 'R3871:Snx33'

276564

Institutional Source

Beutler Lab

Gene Symbol

Snx33

Ensembl Gene

ENSMUSG00000032733

Gene Name

sorting nexin 33

Synonyms

Sh3px3, E130307J07Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R3871 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

56917193-56928371 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 56926740 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 15 (N15S)

Ref Sequence

ENSEMBL: ENSMUSP00000060225 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050916]

Predicted Effect

probably benign
Transcript: ENSMUST00000050916
AA Change: N15S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000060225
Gene: ENSMUSG00000032733
AA Change: N15S

Domain	Start	End	E-Value	Type
SH3	3	60	3.2e-15	SMART
low complexity region	111	122	N/A	INTRINSIC
PX	227	336	6.69e-18	SMART
Pfam:BAR_3_WASP_bdg	337	572	1.1e-113	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213112

Meta Mutation Damage Score

0.0735

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in cytoskeletal reorganization, vesicle trafficking, endocytosis, and mitosis. The encoded protein is essential for the creation of the cleavage furrow during mitosis and for completion of mitosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh1a1	T	A	19: 20,624,753	Y225*	probably null	Het
Bard1	T	C	1: 71,074,940	K294R	probably benign	Het
Bcap29	A	T	12: 31,617,081	S194T	probably benign	Het
Ccdc40	G	A	11: 119,264,281	V1116M	probably damaging	Het
Cntnap5a	A	G	1: 116,060,249	E170G	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Cyp2c54	T	C	19: 40,072,423	D92G	probably benign	Het
Dpp6	T	C	5: 27,469,465	F197L	probably benign	Het
Filip1l	G	T	16: 57,513,286	K147N	probably damaging	Het
Hrnr	T	A	3: 93,331,874	S3140T	unknown	Het
Igfn1	G	T	1: 135,968,836	H1331N	probably benign	Het
Kalrn	C	T	16: 34,203,856		probably null	Het
Kmt2d	TTGCTGCTGCTGCTGCTGCTGCTGC	TTGCTGCTGCTGCTGCTGC	15: 98,851,021		probably benign	Het
Mfng	A	G	15: 78,756,621	L308P	probably damaging	Het
Nt5e	C	A	9: 88,364,693	N327K	probably benign	Het
Olfr1025-ps1	T	G	2: 85,918,582		probably null	Het
Pgbd1	C	T	13: 21,434,370	R39H	possibly damaging	Het
Phactr4	T	C	4: 132,377,249	T256A	probably benign	Het
Rab24	T	C	13: 55,321,179	D63G	probably damaging	Het
Rubcnl	C	T	14: 75,040,916	P380L	probably benign	Het
Satb2	A	G	1: 56,891,220	S215P	probably damaging	Het
Serpina3b	A	T	12: 104,138,788	I408F	probably damaging	Het
Setx	A	G	2: 29,145,741	D746G	probably damaging	Het
Sf3a2	A	C	10: 80,804,693		probably benign	Het
Snx9	C	T	17: 5,891,781	P61L	probably benign	Het
Sult2a6	T	C	7: 14,254,776	K20E	probably benign	Het
Tas2r122	A	G	6: 132,711,580	S117P	probably benign	Het
Tmem26	G	A	10: 68,778,732	E326K	probably benign	Het
Tnpo2	T	A	8: 85,054,751	C789S	probably null	Het
Togaram1	A	C	12: 65,002,645	E1285D	probably benign	Het
Ubxn7	T	A	16: 32,381,430	S335T	possibly damaging	Het
Unc119b	G	A	5: 115,130,508	T106M	probably damaging	Het
Usp14	A	G	18: 10,002,370	S314P	possibly damaging	Het
Usp32	T	C	11: 85,081,156	D129G	probably null	Het

Other mutations in Snx33

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02261:Snx33	APN	9	56926578	missense	probably benign
IGL02646:Snx33	APN	9	56926759	missense	probably damaging	1.00
IGL03028:Snx33	APN	9	56926451	missense	probably benign
R0206:Snx33	UTSW	9	56926224	missense	probably damaging	1.00
R0755:Snx33	UTSW	9	56925457	missense	possibly damaging	0.84
R1218:Snx33	UTSW	9	56925985	missense	probably damaging	1.00
R1523:Snx33	UTSW	9	56926182	missense	possibly damaging	0.47
R1627:Snx33	UTSW	9	56925957	missense	probably damaging	1.00
R1758:Snx33	UTSW	9	56926698	missense	probably benign	0.29
R1856:Snx33	UTSW	9	56926011	missense	possibly damaging	0.85
R1885:Snx33	UTSW	9	56925837	missense	probably benign	0.42
R2113:Snx33	UTSW	9	56926440	missense	probably benign	0.28
R2422:Snx33	UTSW	9	56918538	missense	probably benign	0.03
R3789:Snx33	UTSW	9	56918560	missense	probably benign	0.00
R3870:Snx33	UTSW	9	56926740	missense	probably benign	0.05
R4734:Snx33	UTSW	9	56925901	missense	possibly damaging	0.84
R4884:Snx33	UTSW	9	56926180	missense	probably damaging	0.99
R5069:Snx33	UTSW	9	56926191	missense	probably damaging	0.97
R5555:Snx33	UTSW	9	56925397	missense	probably benign
R6153:Snx33	UTSW	9	56926699	missense	possibly damaging	0.74
R7178:Snx33	UTSW	9	56925867	missense	probably damaging	1.00
R7179:Snx33	UTSW	9	56925867	missense	probably damaging	1.00
R7315:Snx33	UTSW	9	56925867	missense	probably damaging	1.00
R7414:Snx33	UTSW	9	56925867	missense	probably damaging	1.00
R7593:Snx33	UTSW	9	56926774	missense	possibly damaging	0.52
R7607:Snx33	UTSW	9	56926713	missense	probably benign
R7632:Snx33	UTSW	9	56926418	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CTCGGGCTGCTATACAAACTCC -3'
(R):5'- AAAGGACTTGGTAGGGCTTAC -3'

Sequencing Primer
(F):5'- GCTATACAAACTCCCCTGGGTG -3'
(R):5'- GGCAAGGCATTTTCCTTC -3'

Posted On

2015-04-06