Incidental Mutation 'R3871:Cyp2c54'
ID 276586
Institutional Source Beutler Lab
Gene Symbol Cyp2c54
Ensembl Gene ENSMUSG00000067225
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 54
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.125) question?
Stock # R3871 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 40026384-40062271 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 40060867 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 92 (D92G)
Ref Sequence ENSEMBL: ENSMUSP00000048284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048959]
AlphaFold Q6XVG2
Predicted Effect probably benign
Transcript: ENSMUST00000048959
AA Change: D92G

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000048284
Gene: ENSMUSG00000067225
AA Change: D92G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:p450 30 487 2.2e-159 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 T A 19: 20,602,117 (GRCm39) Y225* probably null Het
Bard1 T C 1: 71,114,099 (GRCm39) K294R probably benign Het
Bcap29 A T 12: 31,667,080 (GRCm39) S194T probably benign Het
Ccdc40 G A 11: 119,155,107 (GRCm39) V1116M probably damaging Het
Cntnap5a A G 1: 115,987,979 (GRCm39) E170G probably damaging Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Dpp6 T C 5: 27,674,463 (GRCm39) F197L probably benign Het
Filip1l G T 16: 57,333,649 (GRCm39) K147N probably damaging Het
Hrnr T A 3: 93,239,181 (GRCm39) S3140T unknown Het
Igfn1 G T 1: 135,896,574 (GRCm39) H1331N probably benign Het
Kalrn C T 16: 34,024,226 (GRCm39) probably null Het
Kmt2d TTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGC 15: 98,748,902 (GRCm39) probably benign Het
Mfng A G 15: 78,640,821 (GRCm39) L308P probably damaging Het
Nt5e C A 9: 88,246,746 (GRCm39) N327K probably benign Het
Or5m13 T G 2: 85,748,926 (GRCm39) probably null Het
Pgbd1 C T 13: 21,618,540 (GRCm39) R39H possibly damaging Het
Phactr4 T C 4: 132,104,560 (GRCm39) T256A probably benign Het
Rab24 T C 13: 55,468,992 (GRCm39) D63G probably damaging Het
Rubcnl C T 14: 75,278,356 (GRCm39) P380L probably benign Het
Satb2 A G 1: 56,930,379 (GRCm39) S215P probably damaging Het
Serpina3b A T 12: 104,105,047 (GRCm39) I408F probably damaging Het
Setx A G 2: 29,035,753 (GRCm39) D746G probably damaging Het
Sf3a2 A C 10: 80,640,527 (GRCm39) probably benign Het
Snx33 T C 9: 56,834,024 (GRCm39) N15S probably benign Het
Snx9 C T 17: 5,942,056 (GRCm39) P61L probably benign Het
Sult2a6 T C 7: 13,988,701 (GRCm39) K20E probably benign Het
Tas2r122 A G 6: 132,688,543 (GRCm39) S117P probably benign Het
Tmem26 G A 10: 68,614,562 (GRCm39) E326K probably benign Het
Tnpo2 T A 8: 85,781,380 (GRCm39) C789S probably null Het
Togaram1 A C 12: 65,049,419 (GRCm39) E1285D probably benign Het
Ubxn7 T A 16: 32,200,248 (GRCm39) S335T possibly damaging Het
Unc119b G A 5: 115,268,567 (GRCm39) T106M probably damaging Het
Usp14 A G 18: 10,002,370 (GRCm39) S314P possibly damaging Het
Usp32 T C 11: 84,971,982 (GRCm39) D129G probably null Het
Other mutations in Cyp2c54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Cyp2c54 APN 19 40,060,522 (GRCm39) missense probably damaging 1.00
IGL02694:Cyp2c54 APN 19 40,035,987 (GRCm39) missense possibly damaging 0.55
IGL03170:Cyp2c54 APN 19 40,060,809 (GRCm39) critical splice donor site probably null
IGL03175:Cyp2c54 APN 19 40,058,672 (GRCm39) missense probably benign 0.00
R0097:Cyp2c54 UTSW 19 40,036,103 (GRCm39) splice site probably benign
R0097:Cyp2c54 UTSW 19 40,036,102 (GRCm39) splice site probably benign
R0391:Cyp2c54 UTSW 19 40,060,613 (GRCm39) missense possibly damaging 0.61
R0581:Cyp2c54 UTSW 19 40,035,999 (GRCm39) missense probably benign 0.23
R0787:Cyp2c54 UTSW 19 40,036,079 (GRCm39) missense probably benign 0.12
R1253:Cyp2c54 UTSW 19 40,034,629 (GRCm39) missense probably damaging 1.00
R1481:Cyp2c54 UTSW 19 40,036,032 (GRCm39) missense probably benign 0.30
R1604:Cyp2c54 UTSW 19 40,058,787 (GRCm39) missense probably benign 0.01
R3624:Cyp2c54 UTSW 19 40,058,688 (GRCm39) missense probably benign 0.21
R3983:Cyp2c54 UTSW 19 40,034,699 (GRCm39) missense possibly damaging 0.49
R4401:Cyp2c54 UTSW 19 40,060,615 (GRCm39) missense probably benign 0.04
R4416:Cyp2c54 UTSW 19 40,026,703 (GRCm39) missense probably benign 0.04
R4962:Cyp2c54 UTSW 19 40,060,585 (GRCm39) missense possibly damaging 0.90
R5203:Cyp2c54 UTSW 19 40,060,918 (GRCm39) missense probably damaging 1.00
R5634:Cyp2c54 UTSW 19 40,060,858 (GRCm39) missense possibly damaging 0.84
R6083:Cyp2c54 UTSW 19 40,062,206 (GRCm39) missense probably benign 0.20
R6182:Cyp2c54 UTSW 19 40,036,005 (GRCm39) missense probably benign
R6754:Cyp2c54 UTSW 19 40,060,004 (GRCm39) missense probably damaging 1.00
R6901:Cyp2c54 UTSW 19 40,058,703 (GRCm39) missense probably damaging 1.00
R6948:Cyp2c54 UTSW 19 40,034,636 (GRCm39) missense possibly damaging 0.73
R7215:Cyp2c54 UTSW 19 40,034,626 (GRCm39) missense probably damaging 1.00
R7244:Cyp2c54 UTSW 19 40,035,953 (GRCm39) missense probably damaging 1.00
R7278:Cyp2c54 UTSW 19 40,058,697 (GRCm39) nonsense probably null
R7535:Cyp2c54 UTSW 19 40,058,716 (GRCm39) missense probably benign
R7838:Cyp2c54 UTSW 19 40,058,688 (GRCm39) missense probably benign 0.21
R8039:Cyp2c54 UTSW 19 40,062,176 (GRCm39) frame shift probably null
R8275:Cyp2c54 UTSW 19 40,026,749 (GRCm39) missense probably benign 0.00
R8340:Cyp2c54 UTSW 19 40,060,831 (GRCm39) missense possibly damaging 0.94
R8367:Cyp2c54 UTSW 19 40,062,125 (GRCm39) missense probably damaging 0.99
R8477:Cyp2c54 UTSW 19 40,058,708 (GRCm39) missense probably benign 0.43
R8487:Cyp2c54 UTSW 19 40,059,990 (GRCm39) missense probably damaging 1.00
R8519:Cyp2c54 UTSW 19 40,026,857 (GRCm39) missense probably damaging 0.99
R8534:Cyp2c54 UTSW 19 40,036,030 (GRCm39) missense probably damaging 0.99
R8858:Cyp2c54 UTSW 19 40,062,227 (GRCm39) missense probably benign 0.00
R9215:Cyp2c54 UTSW 19 40,035,950 (GRCm39) missense possibly damaging 0.52
R9236:Cyp2c54 UTSW 19 40,060,938 (GRCm39) nonsense probably null
R9470:Cyp2c54 UTSW 19 40,060,888 (GRCm39) missense probably damaging 1.00
R9792:Cyp2c54 UTSW 19 40,034,525 (GRCm39) missense probably damaging 1.00
Z1176:Cyp2c54 UTSW 19 40,034,659 (GRCm39) missense probably damaging 1.00
Z1177:Cyp2c54 UTSW 19 40,062,201 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ACAGACATTACAGAGTAAATCCTGG -3'
(R):5'- TTGCGCAGTACTATTACCAGTC -3'

Sequencing Primer
(F):5'- ACATTACAGAGTAAATCCTGGAGTAG -3'
(R):5'- GCGCAGTACTATTACCAGTCTAAAAG -3'
Posted On 2015-04-06