Incidental Mutation 'R3872:Olfr1156'
ID276592
Institutional Source Beutler Lab
Gene Symbol Olfr1156
Ensembl Gene ENSMUSG00000075144
Gene Nameolfactory receptor 1156
SynonymsMOR174-3, GA_x6K02T2Q125-49433499-49432537
MMRRC Submission 040790-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R3872 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87947053-87953100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87949530 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 234 (R234S)
Ref Sequence ENSEMBL: ENSMUSP00000149665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099842] [ENSMUST00000215903] [ENSMUST00000216191] [ENSMUST00000216726]
Predicted Effect probably damaging
Transcript: ENSMUST00000099842
AA Change: R234S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097430
Gene: ENSMUSG00000075144
AA Change: R234S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.2e-47 PFAM
Pfam:7tm_1 41 290 1.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215903
Predicted Effect probably damaging
Transcript: ENSMUST00000216191
AA Change: R234S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216726
AA Change: R234S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk T C 11: 120,010,219 E1117G possibly damaging Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Baz2a T A 10: 128,124,110 M1419K probably damaging Het
BC055324 A T 1: 163,986,964 S137T probably damaging Het
Bhmt-ps1 T C 4: 26,369,201 noncoding transcript Het
Cabcoco1 T C 10: 68,516,278 Y68C probably damaging Het
Car12 C A 9: 66,717,552 probably benign Het
Cic T C 7: 25,271,699 V285A possibly damaging Het
Col19a1 A G 1: 24,575,327 probably benign Het
Col6a4 T C 9: 106,013,659 N1812S possibly damaging Het
Cry1 T C 10: 85,133,160 probably null Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dlx5 G T 6: 6,878,209 P274T probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dnah5 A G 15: 28,411,510 K3675R possibly damaging Het
Dpp6 A G 5: 27,721,058 Y710C probably damaging Het
Dsc3 C A 18: 19,971,508 K587N probably damaging Het
Epcam C A 17: 87,639,926 T36K possibly damaging Het
Epha2 T C 4: 141,308,405 W51R probably damaging Het
Eya4 A T 10: 23,155,972 I251N probably damaging Het
Fbxo21 G A 5: 118,000,329 V447I possibly damaging Het
Frg2f1 T A 4: 119,530,958 T115S possibly damaging Het
Gm8332 T C 12: 88,249,706 D132G unknown Het
Hecw2 A T 1: 53,832,757 probably benign Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Iqca A T 1: 90,089,481 Y411N probably damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Klhl1 A G 14: 96,518,179 F47L probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Krt34 T C 11: 100,041,417 H27R probably benign Het
Mia3 T C 1: 183,356,998 E791G probably benign Het
Mroh2b A T 15: 4,925,061 K669* probably null Het
Msmo1 C T 8: 64,722,463 probably null Het
Muc6 T C 7: 141,640,600 T1387A probably benign Het
Myo1g C T 11: 6,514,886 V463I possibly damaging Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Pde10a C A 17: 8,757,091 T16K possibly damaging Het
Pfas T C 11: 69,000,263 T310A probably damaging Het
Phb2 G A 6: 124,716,431 probably null Het
Plin3 A G 17: 56,284,181 S200P probably damaging Het
Plxna1 C A 6: 89,332,692 E1087* probably null Het
Rnf17 G T 14: 56,475,413 R779L possibly damaging Het
Sacs C T 14: 61,148,068 T6M probably benign Het
Scfd1 A G 12: 51,392,196 Y147C probably damaging Het
Sept1 T C 7: 127,215,275 probably benign Het
Sept5 A G 16: 18,622,973 L344P probably damaging Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Slc35f1 A G 10: 53,021,910 D139G possibly damaging Het
Sod3 A G 5: 52,368,289 Y110C probably damaging Het
Stk35 T C 2: 129,810,575 V332A possibly damaging Het
Tacc2 C T 7: 130,622,422 T279M probably benign Het
Tdo2 T C 3: 81,968,086 E187G probably benign Het
Tmem150b A T 7: 4,724,361 Y48* probably null Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r60 C T 7: 42,136,454 S227L probably benign Het
Vps33a C T 5: 123,531,192 V549I probably benign Het
Zfp788 T A 7: 41,649,444 Y449* probably null Het
Other mutations in Olfr1156
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Olfr1156 APN 2 87949863 missense probably damaging 0.99
IGL02831:Olfr1156 APN 2 87949676 splice site probably null
IGL03214:Olfr1156 APN 2 87950071 missense probably benign 0.16
R0285:Olfr1156 UTSW 2 87950131 missense probably damaging 0.98
R0926:Olfr1156 UTSW 2 87949922 missense probably damaging 1.00
R0987:Olfr1156 UTSW 2 87949547 missense probably benign 0.12
R1422:Olfr1156 UTSW 2 87950095 missense probably benign 0.00
R1958:Olfr1156 UTSW 2 87949465 missense probably damaging 1.00
R2239:Olfr1156 UTSW 2 87949397 missense probably damaging 1.00
R2380:Olfr1156 UTSW 2 87949397 missense probably damaging 1.00
R3873:Olfr1156 UTSW 2 87949530 missense probably damaging 1.00
R3874:Olfr1156 UTSW 2 87949530 missense probably damaging 1.00
R4526:Olfr1156 UTSW 2 87949409 missense probably benign 0.09
R5116:Olfr1156 UTSW 2 87949529 missense probably benign 0.03
R5985:Olfr1156 UTSW 2 87949321 missense probably benign 0.02
R5999:Olfr1156 UTSW 2 87949801 splice site probably null
R6127:Olfr1156 UTSW 2 87949361 missense probably damaging 1.00
R6259:Olfr1156 UTSW 2 87949435 missense probably benign 0.20
R6544:Olfr1156 UTSW 2 87949991 missense probably benign 0.35
R6556:Olfr1156 UTSW 2 87949976 missense probably benign 0.00
R6715:Olfr1156 UTSW 2 87949991 missense probably benign 0.35
R6951:Olfr1156 UTSW 2 87949979 missense possibly damaging 0.79
R7062:Olfr1156 UTSW 2 87950224 missense probably benign 0.01
R7142:Olfr1156 UTSW 2 87949712 missense probably benign 0.09
R7749:Olfr1156 UTSW 2 87949478 missense probably damaging 1.00
R7887:Olfr1156 UTSW 2 87949880 missense probably damaging 1.00
R8222:Olfr1156 UTSW 2 87949444 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATCCTTATTCCTCAGACTGTAG -3'
(R):5'- TGCTTGGCCCTTGAGATCAC -3'

Sequencing Primer
(F):5'- CTGTAGATCAGGGGGTTCAGC -3'
(R):5'- GCCCTTGAGATCACATCATTTAAATC -3'
Posted On2015-04-06