Incidental Mutation 'R3872:Stk35'
ID 276594
Institutional Source Beutler Lab
Gene Symbol Stk35
Ensembl Gene ENSMUSG00000037885
Gene Name serine/threonine kinase 35
Synonyms 1700054C12Rik, CLIK1, CLP-36 interacting kinase
MMRRC Submission 040790-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3872 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 129800517-129832287 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 129810575 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 332 (V332A)
Ref Sequence ENSEMBL: ENSMUSP00000126541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165413] [ENSMUST00000166282]
AlphaFold Q80ZW0
Predicted Effect possibly damaging
Transcript: ENSMUST00000165413
AA Change: V332A

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126541
Gene: ENSMUSG00000037885
AA Change: V332A

DomainStartEndE-ValueType
low complexity region 51 69 N/A INTRINSIC
low complexity region 115 137 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
Pfam:Pkinase_Tyr 207 295 2e-6 PFAM
Pfam:Pkinase 207 531 8.6e-51 PFAM
Pfam:Pkinase_Tyr 304 532 2.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166282
SMART Domains Protein: ENSMUSP00000132862
Gene: ENSMUSG00000037885

DomainStartEndE-ValueType
low complexity region 51 69 N/A INTRINSIC
low complexity region 115 137 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
Pfam:Pkinase_Tyr 207 300 5.9e-7 PFAM
Pfam:Pkinase 207 311 1e-9 PFAM
Meta Mutation Damage Score 0.6786 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinase that is predominantly found in the nucleus. However, it can interact with PDLIM1/CLP-36 in the cytoplasm and localize to actin stress fibers. The encoded protein may be a regulator of actin stress fibers in nonmuscle cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk T C 11: 120,010,219 E1117G possibly damaging Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Baz2a T A 10: 128,124,110 M1419K probably damaging Het
BC055324 A T 1: 163,986,964 S137T probably damaging Het
Bhmt-ps1 T C 4: 26,369,201 noncoding transcript Het
Cabcoco1 T C 10: 68,516,278 Y68C probably damaging Het
Car12 C A 9: 66,717,552 probably benign Het
Cic T C 7: 25,271,699 V285A possibly damaging Het
Col19a1 A G 1: 24,575,327 probably benign Het
Col6a4 T C 9: 106,013,659 N1812S possibly damaging Het
Cry1 T C 10: 85,133,160 probably null Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dlx5 G T 6: 6,878,209 P274T probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dnah5 A G 15: 28,411,510 K3675R possibly damaging Het
Dpp6 A G 5: 27,721,058 Y710C probably damaging Het
Dsc3 C A 18: 19,971,508 K587N probably damaging Het
Epcam C A 17: 87,639,926 T36K possibly damaging Het
Epha2 T C 4: 141,308,405 W51R probably damaging Het
Eya4 A T 10: 23,155,972 I251N probably damaging Het
Fbxo21 G A 5: 118,000,329 V447I possibly damaging Het
Frg2f1 T A 4: 119,530,958 T115S possibly damaging Het
Gm8332 T C 12: 88,249,706 D132G unknown Het
Hecw2 A T 1: 53,832,757 probably benign Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Iqca A T 1: 90,089,481 Y411N probably damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Klhl1 A G 14: 96,518,179 F47L probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Krt34 T C 11: 100,041,417 H27R probably benign Het
Mia3 T C 1: 183,356,998 E791G probably benign Het
Mroh2b A T 15: 4,925,061 K669* probably null Het
Msmo1 C T 8: 64,722,463 probably null Het
Muc6 T C 7: 141,640,600 T1387A probably benign Het
Myo1g C T 11: 6,514,886 V463I possibly damaging Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Pde10a C A 17: 8,757,091 T16K possibly damaging Het
Pfas T C 11: 69,000,263 T310A probably damaging Het
Phb2 G A 6: 124,716,431 probably null Het
Plin3 A G 17: 56,284,181 S200P probably damaging Het
Plxna1 C A 6: 89,332,692 E1087* probably null Het
Rnf17 G T 14: 56,475,413 R779L possibly damaging Het
Sacs C T 14: 61,148,068 T6M probably benign Het
Scfd1 A G 12: 51,392,196 Y147C probably damaging Het
Sept1 T C 7: 127,215,275 probably benign Het
Sept5 A G 16: 18,622,973 L344P probably damaging Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Slc35f1 A G 10: 53,021,910 D139G possibly damaging Het
Sod3 A G 5: 52,368,289 Y110C probably damaging Het
Tacc2 C T 7: 130,622,422 T279M probably benign Het
Tdo2 T C 3: 81,968,086 E187G probably benign Het
Tmem150b A T 7: 4,724,361 Y48* probably null Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r60 C T 7: 42,136,454 S227L probably benign Het
Vps33a C T 5: 123,531,192 V549I probably benign Het
Zfp788 T A 7: 41,649,444 Y449* probably null Het
Other mutations in Stk35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Stk35 APN 2 129801992 missense probably damaging 1.00
IGL02609:Stk35 APN 2 129801801 missense probably damaging 1.00
fingernails UTSW 2 129810935 missense probably damaging 1.00
R2256_Stk35_331 UTSW 2 129810507 nonsense probably null
skinned UTSW 2 129811235 intron probably benign
R0045:Stk35 UTSW 2 129800568 nonsense probably null
R0306:Stk35 UTSW 2 129801763 nonsense probably null
R0784:Stk35 UTSW 2 129810802 nonsense probably null
R1536:Stk35 UTSW 2 129811235 intron probably benign
R2256:Stk35 UTSW 2 129810507 nonsense probably null
R2507:Stk35 UTSW 2 129801515 missense probably damaging 0.97
R2508:Stk35 UTSW 2 129801515 missense probably damaging 0.97
R3848:Stk35 UTSW 2 129800736 missense probably benign 0.13
R4466:Stk35 UTSW 2 129801516 missense probably damaging 0.99
R5144:Stk35 UTSW 2 129810935 missense probably damaging 1.00
R6267:Stk35 UTSW 2 129810888 nonsense probably null
R6296:Stk35 UTSW 2 129810888 nonsense probably null
R6480:Stk35 UTSW 2 129810687 missense possibly damaging 0.95
R6807:Stk35 UTSW 2 129801653 missense probably damaging 0.97
R7203:Stk35 UTSW 2 129801593 missense probably benign
R7476:Stk35 UTSW 2 129810725 missense probably damaging 1.00
R8505:Stk35 UTSW 2 129801729 missense probably damaging 0.99
R8998:Stk35 UTSW 2 129810589 missense probably damaging 1.00
R8999:Stk35 UTSW 2 129810589 missense probably damaging 1.00
R9224:Stk35 UTSW 2 129810571 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCGGGCATAGACTTTG -3'
(R):5'- ACCTTGCTCAGTCCAAAGTC -3'

Sequencing Primer
(F):5'- CAGTTGTGTAGATCCTCATGGCAC -3'
(R):5'- CAAAGTCTGCCACCTTGAGGATG -3'
Posted On 2015-04-06