Mutagenetix > Incidental Mutations

Incidental Mutation 'R3872:Stk35'

276594

Institutional Source

Beutler Lab

Gene Symbol

Stk35

Ensembl Gene

ENSMUSG00000037885

Gene Name

serine/threonine kinase 35

Synonyms

1700054C12Rik, CLIK1, CLP-36 interacting kinase

MMRRC Submission

040790-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3872 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

129800517-129832287 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 129810575 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 332 (V332A)

Ref Sequence

ENSEMBL: ENSMUSP00000126541 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165413] [ENSMUST00000166282]

AlphaFold

Q80ZW0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000165413
AA Change: V332A

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000126541
Gene: ENSMUSG00000037885
AA Change: V332A

Domain	Start	End	E-Value	Type
low complexity region	51	69	N/A	INTRINSIC
low complexity region	115	137	N/A	INTRINSIC
low complexity region	190	206	N/A	INTRINSIC
Pfam:Pkinase_Tyr	207	295	2e-6	PFAM
Pfam:Pkinase	207	531	8.6e-51	PFAM
Pfam:Pkinase_Tyr	304	532	2.1e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166282

SMART Domains

Protein: ENSMUSP00000132862
Gene: ENSMUSG00000037885

Domain	Start	End	E-Value	Type
low complexity region	51	69	N/A	INTRINSIC
low complexity region	115	137	N/A	INTRINSIC
low complexity region	190	206	N/A	INTRINSIC
Pfam:Pkinase_Tyr	207	300	5.9e-7	PFAM
Pfam:Pkinase	207	311	1e-9	PFAM

Meta Mutation Damage Score

0.6786

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.7%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinase that is predominantly found in the nucleus. However, it can interact with PDLIM1/CLP-36 in the cytoplasm and localize to actin stress fibers. The encoded protein may be a regulator of actin stress fibers in nonmuscle cells. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	T	C	11: 120,010,219	E1117G	possibly damaging	Het
Abca5	T	A	11: 110,310,233	Y447F	probably damaging	Het
Akap12	G	A	10: 4,357,590	V1467I	probably benign	Het
Baz2a	T	A	10: 128,124,110	M1419K	probably damaging	Het
BC055324	A	T	1: 163,986,964	S137T	probably damaging	Het
Bhmt-ps1	T	C	4: 26,369,201		noncoding transcript	Het
Cabcoco1	T	C	10: 68,516,278	Y68C	probably damaging	Het
Car12	C	A	9: 66,717,552		probably benign	Het
Cic	T	C	7: 25,271,699	V285A	possibly damaging	Het
Col19a1	A	G	1: 24,575,327		probably benign	Het
Col6a4	T	C	9: 106,013,659	N1812S	possibly damaging	Het
Cry1	T	C	10: 85,133,160		probably null	Het
Dlgap4	T	C	2: 156,749,347	S818P	probably benign	Het
Dlx5	G	T	6: 6,878,209	P274T	probably benign	Het
Dnah2	A	G	11: 69,429,348	I3965T	probably damaging	Het
Dnah5	A	G	15: 28,411,510	K3675R	possibly damaging	Het
Dpp6	A	G	5: 27,721,058	Y710C	probably damaging	Het
Dsc3	C	A	18: 19,971,508	K587N	probably damaging	Het
Epcam	C	A	17: 87,639,926	T36K	possibly damaging	Het
Epha2	T	C	4: 141,308,405	W51R	probably damaging	Het
Eya4	A	T	10: 23,155,972	I251N	probably damaging	Het
Fbxo21	G	A	5: 118,000,329	V447I	possibly damaging	Het
Frg2f1	T	A	4: 119,530,958	T115S	possibly damaging	Het
Gm8332	T	C	12: 88,249,706	D132G	unknown	Het
Hecw2	A	T	1: 53,832,757		probably benign	Het
Igfals	G	A	17: 24,881,605	V557I	possibly damaging	Het
Iqca	A	T	1: 90,089,481	Y411N	probably damaging	Het
Itpa	T	G	2: 130,681,010	S176A	probably damaging	Het
Klhl1	A	G	14: 96,518,179	F47L	probably benign	Het
Krt26	T	C	11: 99,334,744	K304E	probably damaging	Het
Krt34	T	C	11: 100,041,417	H27R	probably benign	Het
Mia3	T	C	1: 183,356,998	E791G	probably benign	Het
Mroh2b	A	T	15: 4,925,061	K669*	probably null	Het
Msmo1	C	T	8: 64,722,463		probably null	Het
Muc6	T	C	7: 141,640,600	T1387A	probably benign	Het
Myo1g	C	T	11: 6,514,886	V463I	possibly damaging	Het
Olfr101	T	A	17: 37,299,979	T148S	probably benign	Het
Olfr1156	T	A	2: 87,949,530	R234S	probably damaging	Het
Olfr1310	T	C	2: 112,008,323	T288A	possibly damaging	Het
Olfr192	G	A	16: 59,098,761	T77I	unknown	Het
Pde10a	C	A	17: 8,757,091	T16K	possibly damaging	Het
Pfas	T	C	11: 69,000,263	T310A	probably damaging	Het
Phb2	G	A	6: 124,716,431		probably null	Het
Plin3	A	G	17: 56,284,181	S200P	probably damaging	Het
Plxna1	C	A	6: 89,332,692	E1087*	probably null	Het
Rnf17	G	T	14: 56,475,413	R779L	possibly damaging	Het
Sacs	C	T	14: 61,148,068	T6M	probably benign	Het
Scfd1	A	G	12: 51,392,196	Y147C	probably damaging	Het
Sept1	T	C	7: 127,215,275		probably benign	Het
Sept5	A	G	16: 18,622,973	L344P	probably damaging	Het
Sgsh	A	G	11: 119,350,947	L111P	probably damaging	Het
Slc35f1	A	G	10: 53,021,910	D139G	possibly damaging	Het
Sod3	A	G	5: 52,368,289	Y110C	probably damaging	Het
Tacc2	C	T	7: 130,622,422	T279M	probably benign	Het
Tdo2	T	C	3: 81,968,086	E187G	probably benign	Het
Tmem150b	A	T	7: 4,724,361	Y48*	probably null	Het
Usp34	C	T	11: 23,489,033	P3532S	possibly damaging	Het
Vmn2r60	C	T	7: 42,136,454	S227L	probably benign	Het
Vps33a	C	T	5: 123,531,192	V549I	probably benign	Het
Zfp788	T	A	7: 41,649,444	Y449*	probably null	Het

Other mutations in Stk35

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Stk35	APN	2	129801992	missense	probably damaging	1.00
IGL02609:Stk35	APN	2	129801801	missense	probably damaging	1.00
fingernails	UTSW	2	129810935	missense	probably damaging	1.00
R2256_Stk35_331	UTSW	2	129810507	nonsense	probably null
skinned	UTSW	2	129811235	intron	probably benign
R0045:Stk35	UTSW	2	129800568	nonsense	probably null
R0306:Stk35	UTSW	2	129801763	nonsense	probably null
R0784:Stk35	UTSW	2	129810802	nonsense	probably null
R1536:Stk35	UTSW	2	129811235	intron	probably benign
R2256:Stk35	UTSW	2	129810507	nonsense	probably null
R2507:Stk35	UTSW	2	129801515	missense	probably damaging	0.97
R2508:Stk35	UTSW	2	129801515	missense	probably damaging	0.97
R3848:Stk35	UTSW	2	129800736	missense	probably benign	0.13
R4466:Stk35	UTSW	2	129801516	missense	probably damaging	0.99
R5144:Stk35	UTSW	2	129810935	missense	probably damaging	1.00
R6267:Stk35	UTSW	2	129810888	nonsense	probably null
R6296:Stk35	UTSW	2	129810888	nonsense	probably null
R6480:Stk35	UTSW	2	129810687	missense	possibly damaging	0.95
R6807:Stk35	UTSW	2	129801653	missense	probably damaging	0.97
R7203:Stk35	UTSW	2	129801593	missense	probably benign
R7476:Stk35	UTSW	2	129810725	missense	probably damaging	1.00
R8505:Stk35	UTSW	2	129801729	missense	probably damaging	0.99
R8998:Stk35	UTSW	2	129810589	missense	probably damaging	1.00
R8999:Stk35	UTSW	2	129810589	missense	probably damaging	1.00
R9224:Stk35	UTSW	2	129810571	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGCGGGCATAGACTTTG -3'
(R):5'- ACCTTGCTCAGTCCAAAGTC -3'

Sequencing Primer
(F):5'- CAGTTGTGTAGATCCTCATGGCAC -3'
(R):5'- CAAAGTCTGCCACCTTGAGGATG -3'

Posted On

2015-04-06