Incidental Mutation 'R3872:Plxna1'
ID276606
Institutional Source Beutler Lab
Gene Symbol Plxna1
Ensembl Gene ENSMUSG00000030084
Gene Nameplexin A1
SynonymsNOV, Plxn1, PlexA1, 2600013D04Rik
MMRRC Submission 040790-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.892) question?
Stock #R3872 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location89316314-89362620 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 89332692 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 1087 (E1087*)
Ref Sequence ENSEMBL: ENSMUSP00000131840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049845] [ENSMUST00000163139]
Predicted Effect probably null
Transcript: ENSMUST00000049845
AA Change: E1087*
SMART Domains Protein: ENSMUSP00000063066
Gene: ENSMUSG00000030084
AA Change: E1087*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1316 1864 8.8e-263 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163139
AA Change: E1087*
SMART Domains Protein: ENSMUSP00000131840
Gene: ENSMUSG00000030084
AA Change: E1087*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1315 1864 2.5e-264 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204997
Predicted Effect probably benign
Transcript: ENSMUST00000205121
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (61/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit bone cellularity abnormalities, altered dendritic cell physiology, abnormal proprioceptive and oligodendrocyte morphology, and increased lymphatic branching complexity and LEC numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk T C 11: 120,010,219 E1117G possibly damaging Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Baz2a T A 10: 128,124,110 M1419K probably damaging Het
BC055324 A T 1: 163,986,964 S137T probably damaging Het
Bhmt-ps1 T C 4: 26,369,201 noncoding transcript Het
Cabcoco1 T C 10: 68,516,278 Y68C probably damaging Het
Car12 C A 9: 66,717,552 probably benign Het
Cic T C 7: 25,271,699 V285A possibly damaging Het
Col19a1 A G 1: 24,575,327 probably benign Het
Col6a4 T C 9: 106,013,659 N1812S possibly damaging Het
Cry1 T C 10: 85,133,160 probably null Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dlx5 G T 6: 6,878,209 P274T probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dnah5 A G 15: 28,411,510 K3675R possibly damaging Het
Dpp6 A G 5: 27,721,058 Y710C probably damaging Het
Dsc3 C A 18: 19,971,508 K587N probably damaging Het
Epcam C A 17: 87,639,926 T36K possibly damaging Het
Epha2 T C 4: 141,308,405 W51R probably damaging Het
Eya4 A T 10: 23,155,972 I251N probably damaging Het
Fbxo21 G A 5: 118,000,329 V447I possibly damaging Het
Frg2f1 T A 4: 119,530,958 T115S possibly damaging Het
Gm8332 T C 12: 88,249,706 D132G unknown Het
Hecw2 A T 1: 53,832,757 probably benign Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Iqca A T 1: 90,089,481 Y411N probably damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Klhl1 A G 14: 96,518,179 F47L probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Krt34 T C 11: 100,041,417 H27R probably benign Het
Mia3 T C 1: 183,356,998 E791G probably benign Het
Mroh2b A T 15: 4,925,061 K669* probably null Het
Msmo1 C T 8: 64,722,463 probably null Het
Muc6 T C 7: 141,640,600 T1387A probably benign Het
Myo1g C T 11: 6,514,886 V463I possibly damaging Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Pde10a C A 17: 8,757,091 T16K possibly damaging Het
Pfas T C 11: 69,000,263 T310A probably damaging Het
Phb2 G A 6: 124,716,431 probably null Het
Plin3 A G 17: 56,284,181 S200P probably damaging Het
Rnf17 G T 14: 56,475,413 R779L possibly damaging Het
Sacs C T 14: 61,148,068 T6M probably benign Het
Scfd1 A G 12: 51,392,196 Y147C probably damaging Het
Sept1 T C 7: 127,215,275 probably benign Het
Sept5 A G 16: 18,622,973 L344P probably damaging Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Slc35f1 A G 10: 53,021,910 D139G possibly damaging Het
Sod3 A G 5: 52,368,289 Y110C probably damaging Het
Stk35 T C 2: 129,810,575 V332A possibly damaging Het
Tacc2 C T 7: 130,622,422 T279M probably benign Het
Tdo2 T C 3: 81,968,086 E187G probably benign Het
Tmem150b A T 7: 4,724,361 Y48* probably null Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r60 C T 7: 42,136,454 S227L probably benign Het
Vps33a C T 5: 123,531,192 V549I probably benign Het
Zfp788 T A 7: 41,649,444 Y449* probably null Het
Other mutations in Plxna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Plxna1 APN 6 89320998 missense probably damaging 1.00
IGL01358:Plxna1 APN 6 89322750 missense probably damaging 1.00
IGL01475:Plxna1 APN 6 89354888 missense possibly damaging 0.92
IGL01480:Plxna1 APN 6 89344096 missense possibly damaging 0.70
IGL01585:Plxna1 APN 6 89329556 critical splice donor site probably null
IGL01804:Plxna1 APN 6 89329646 missense probably damaging 1.00
IGL01909:Plxna1 APN 6 89332084 critical splice donor site probably null
IGL01989:Plxna1 APN 6 89329414 nonsense probably null
IGL02015:Plxna1 APN 6 89342451 missense probably damaging 1.00
IGL02023:Plxna1 APN 6 89357332 missense possibly damaging 0.88
IGL02668:Plxna1 APN 6 89357269 nonsense probably null
IGL02703:Plxna1 APN 6 89356943 missense probably damaging 1.00
IGL02954:Plxna1 APN 6 89324667 missense probably damaging 1.00
IGL03212:Plxna1 APN 6 89331903 missense probably damaging 1.00
PIT4544001:Plxna1 UTSW 6 89357429 missense probably benign 0.14
R0055:Plxna1 UTSW 6 89329739 missense possibly damaging 0.94
R0055:Plxna1 UTSW 6 89329739 missense possibly damaging 0.94
R0147:Plxna1 UTSW 6 89320710 missense possibly damaging 0.95
R0149:Plxna1 UTSW 6 89320613 missense probably null 0.95
R0166:Plxna1 UTSW 6 89333019 missense probably damaging 1.00
R0200:Plxna1 UTSW 6 89323593 missense probably damaging 1.00
R0415:Plxna1 UTSW 6 89357336 missense probably benign 0.12
R0841:Plxna1 UTSW 6 89332204 missense probably damaging 1.00
R1018:Plxna1 UTSW 6 89342960 missense probably damaging 1.00
R1240:Plxna1 UTSW 6 89321050 missense probably damaging 1.00
R1355:Plxna1 UTSW 6 89320766 unclassified probably benign
R1700:Plxna1 UTSW 6 89357008 missense probably damaging 1.00
R1776:Plxna1 UTSW 6 89335464 missense probably benign 0.00
R1957:Plxna1 UTSW 6 89331291 missense probably damaging 1.00
R2314:Plxna1 UTSW 6 89324316 missense probably damaging 1.00
R2968:Plxna1 UTSW 6 89342608 missense probably damaging 1.00
R3118:Plxna1 UTSW 6 89356976 missense possibly damaging 0.89
R3522:Plxna1 UTSW 6 89337353 critical splice acceptor site probably null
R3619:Plxna1 UTSW 6 89357453 missense probably damaging 0.97
R3766:Plxna1 UTSW 6 89334775 unclassified probably benign
R3847:Plxna1 UTSW 6 89356519 missense probably damaging 1.00
R3849:Plxna1 UTSW 6 89356519 missense probably damaging 1.00
R4555:Plxna1 UTSW 6 89323328 missense probably damaging 0.99
R4709:Plxna1 UTSW 6 89334751 missense possibly damaging 0.72
R4726:Plxna1 UTSW 6 89322816 missense probably damaging 1.00
R4739:Plxna1 UTSW 6 89332675 splice site probably null
R5053:Plxna1 UTSW 6 89322460 missense probably damaging 1.00
R5221:Plxna1 UTSW 6 89321016 missense probably damaging 1.00
R5449:Plxna1 UTSW 6 89323608 missense probably damaging 1.00
R5480:Plxna1 UTSW 6 89324634 missense probably damaging 1.00
R5575:Plxna1 UTSW 6 89324541 missense possibly damaging 0.83
R5743:Plxna1 UTSW 6 89356529 missense probably damaging 1.00
R5744:Plxna1 UTSW 6 89334682 missense possibly damaging 0.67
R5754:Plxna1 UTSW 6 89333105 missense possibly damaging 0.96
R5868:Plxna1 UTSW 6 89322722 splice site probably benign
R5988:Plxna1 UTSW 6 89357540 nonsense probably null
R6190:Plxna1 UTSW 6 89356604 nonsense probably null
R6425:Plxna1 UTSW 6 89334665 missense probably benign 0.00
R6561:Plxna1 UTSW 6 89356978 missense probably damaging 1.00
R6623:Plxna1 UTSW 6 89322771 missense probably damaging 1.00
R6638:Plxna1 UTSW 6 89324400 missense probably damaging 0.97
R6701:Plxna1 UTSW 6 89319448 missense probably damaging 0.99
R6825:Plxna1 UTSW 6 89320615 missense probably benign 0.01
R6911:Plxna1 UTSW 6 89320974 missense probably damaging 1.00
R7073:Plxna1 UTSW 6 89357329 missense probably damaging 1.00
R7177:Plxna1 UTSW 6 89323329 missense possibly damaging 0.50
R7235:Plxna1 UTSW 6 89340591 missense probably damaging 0.97
R7419:Plxna1 UTSW 6 89357602 missense unknown
R7511:Plxna1 UTSW 6 89341907 missense possibly damaging 0.71
R7543:Plxna1 UTSW 6 89322855 missense probably damaging 1.00
R7665:Plxna1 UTSW 6 89324538 critical splice donor site probably null
R7678:Plxna1 UTSW 6 89331900 missense probably damaging 0.99
R7748:Plxna1 UTSW 6 89337352 critical splice acceptor site probably null
R7748:Plxna1 UTSW 6 89337353 critical splice acceptor site probably null
R7877:Plxna1 UTSW 6 89323259 missense probably damaging 0.99
R8025:Plxna1 UTSW 6 89331272 missense probably damaging 1.00
R8171:Plxna1 UTSW 6 89357120 missense probably benign 0.20
R8277:Plxna1 UTSW 6 89357180 missense probably damaging 1.00
R8782:Plxna1 UTSW 6 89323238 missense probably damaging 1.00
R8867:Plxna1 UTSW 6 89333097 missense probably benign 0.00
S24628:Plxna1 UTSW 6 89357336 missense probably benign 0.12
V8831:Plxna1 UTSW 6 89357137 missense probably damaging 0.99
Z1176:Plxna1 UTSW 6 89321052 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTTTGTCCTCAAGGCCTCAG -3'
(R):5'- TTCAGCAACAGCCTCCTAAG -3'

Sequencing Primer
(F):5'- GCCTCAGCACAGACAGGTAAG -3'
(R):5'- AGGTCCTTAATCCTGGCAAGTAG -3'
Posted On2015-04-06