Incidental Mutation 'R3872:Vmn2r60'
ID276611
Institutional Source Beutler Lab
Gene Symbol Vmn2r60
Ensembl Gene ENSMUSG00000090619
Gene Namevomeronasal 2, receptor 60
SynonymsGprc2a-rs3, Casr-rs3, EG637898
MMRRC Submission 040790-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R3872 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location42116471-42195776 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 42136454 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 227 (S227L)
Ref Sequence ENSEMBL: ENSMUSP00000128493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166447]
Predicted Effect probably benign
Transcript: ENSMUST00000166447
AA Change: S227L

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128493
Gene: ENSMUSG00000090619
AA Change: S227L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 78 471 1.2e-44 PFAM
Pfam:NCD3G 514 567 5.1e-23 PFAM
Pfam:7tm_3 600 835 1.4e-51 PFAM
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk T C 11: 120,010,219 E1117G possibly damaging Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Baz2a T A 10: 128,124,110 M1419K probably damaging Het
BC055324 A T 1: 163,986,964 S137T probably damaging Het
Bhmt-ps1 T C 4: 26,369,201 noncoding transcript Het
Cabcoco1 T C 10: 68,516,278 Y68C probably damaging Het
Car12 C A 9: 66,717,552 probably benign Het
Cic T C 7: 25,271,699 V285A possibly damaging Het
Col19a1 A G 1: 24,575,327 probably benign Het
Col6a4 T C 9: 106,013,659 N1812S possibly damaging Het
Cry1 T C 10: 85,133,160 probably null Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dlx5 G T 6: 6,878,209 P274T probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dnah5 A G 15: 28,411,510 K3675R possibly damaging Het
Dpp6 A G 5: 27,721,058 Y710C probably damaging Het
Dsc3 C A 18: 19,971,508 K587N probably damaging Het
Epcam C A 17: 87,639,926 T36K possibly damaging Het
Epha2 T C 4: 141,308,405 W51R probably damaging Het
Eya4 A T 10: 23,155,972 I251N probably damaging Het
Fbxo21 G A 5: 118,000,329 V447I possibly damaging Het
Frg2f1 T A 4: 119,530,958 T115S possibly damaging Het
Gm8332 T C 12: 88,249,706 D132G unknown Het
Hecw2 A T 1: 53,832,757 probably benign Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Iqca A T 1: 90,089,481 Y411N probably damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Klhl1 A G 14: 96,518,179 F47L probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Krt34 T C 11: 100,041,417 H27R probably benign Het
Mia3 T C 1: 183,356,998 E791G probably benign Het
Mroh2b A T 15: 4,925,061 K669* probably null Het
Msmo1 C T 8: 64,722,463 probably null Het
Muc6 T C 7: 141,640,600 T1387A probably benign Het
Myo1g C T 11: 6,514,886 V463I possibly damaging Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Pde10a C A 17: 8,757,091 T16K possibly damaging Het
Pfas T C 11: 69,000,263 T310A probably damaging Het
Phb2 G A 6: 124,716,431 probably null Het
Plin3 A G 17: 56,284,181 S200P probably damaging Het
Plxna1 C A 6: 89,332,692 E1087* probably null Het
Rnf17 G T 14: 56,475,413 R779L possibly damaging Het
Sacs C T 14: 61,148,068 T6M probably benign Het
Scfd1 A G 12: 51,392,196 Y147C probably damaging Het
Sept1 T C 7: 127,215,275 probably benign Het
Sept5 A G 16: 18,622,973 L344P probably damaging Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Slc35f1 A G 10: 53,021,910 D139G possibly damaging Het
Sod3 A G 5: 52,368,289 Y110C probably damaging Het
Stk35 T C 2: 129,810,575 V332A possibly damaging Het
Tacc2 C T 7: 130,622,422 T279M probably benign Het
Tdo2 T C 3: 81,968,086 E187G probably benign Het
Tmem150b A T 7: 4,724,361 Y48* probably null Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vps33a C T 5: 123,531,192 V549I probably benign Het
Zfp788 T A 7: 41,649,444 Y449* probably null Het
Other mutations in Vmn2r60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Vmn2r60 APN 7 42136486 missense probably benign 0.09
IGL01623:Vmn2r60 APN 7 42136486 missense probably benign 0.09
IGL02363:Vmn2r60 APN 7 42195154 missense probably benign 0.02
IGL02485:Vmn2r60 APN 7 42195466 missense possibly damaging 0.54
IGL02651:Vmn2r60 APN 7 42195586 missense probably damaging 0.99
IGL02660:Vmn2r60 APN 7 42142296 nonsense probably null
IGL03135:Vmn2r60 APN 7 42136594 missense probably benign 0.13
IGL03307:Vmn2r60 APN 7 42116547 missense probably benign 0.14
R0310:Vmn2r60 UTSW 7 42195140 missense possibly damaging 0.54
R0314:Vmn2r60 UTSW 7 42135561 splice site probably benign
R0328:Vmn2r60 UTSW 7 42142320 splice site probably benign
R0464:Vmn2r60 UTSW 7 42135831 missense probably damaging 0.99
R0755:Vmn2r60 UTSW 7 42195445 missense probably damaging 1.00
R1119:Vmn2r60 UTSW 7 42194941 missense possibly damaging 0.68
R1162:Vmn2r60 UTSW 7 42195771 missense probably benign 0.29
R1241:Vmn2r60 UTSW 7 42137052 missense probably benign 0.01
R1404:Vmn2r60 UTSW 7 42136787 missense probably damaging 0.99
R1404:Vmn2r60 UTSW 7 42136787 missense probably damaging 0.99
R1488:Vmn2r60 UTSW 7 42136713 missense probably benign 0.17
R1623:Vmn2r60 UTSW 7 42135855 nonsense probably null
R1628:Vmn2r60 UTSW 7 42136406 nonsense probably null
R1883:Vmn2r60 UTSW 7 42136670 missense probably damaging 0.99
R1884:Vmn2r60 UTSW 7 42136670 missense probably damaging 0.99
R2182:Vmn2r60 UTSW 7 42195507 missense probably benign 0.06
R2275:Vmn2r60 UTSW 7 42136827 nonsense probably null
R2847:Vmn2r60 UTSW 7 42136433 missense probably benign 0.07
R2885:Vmn2r60 UTSW 7 42140979 missense possibly damaging 0.91
R2894:Vmn2r60 UTSW 7 42135796 missense probably benign
R2921:Vmn2r60 UTSW 7 42141035 missense probably damaging 0.98
R2922:Vmn2r60 UTSW 7 42141035 missense probably damaging 0.98
R3772:Vmn2r60 UTSW 7 42116556 missense probably benign 0.35
R3820:Vmn2r60 UTSW 7 42135701 missense probably damaging 0.98
R3822:Vmn2r60 UTSW 7 42135701 missense probably damaging 0.98
R4222:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4223:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4224:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4526:Vmn2r60 UTSW 7 42195243 missense probably damaging 0.96
R4547:Vmn2r60 UTSW 7 42135663 missense probably null 0.54
R4840:Vmn2r60 UTSW 7 42135861 missense probably damaging 1.00
R5173:Vmn2r60 UTSW 7 42195511 missense probably damaging 0.97
R5231:Vmn2r60 UTSW 7 42137024 missense possibly damaging 0.93
R5480:Vmn2r60 UTSW 7 42135730 missense probably damaging 0.98
R5521:Vmn2r60 UTSW 7 42195625 missense probably damaging 0.99
R5834:Vmn2r60 UTSW 7 42116508 missense probably benign 0.17
R6038:Vmn2r60 UTSW 7 42194962 missense probably benign 0.04
R6038:Vmn2r60 UTSW 7 42194962 missense probably benign 0.04
R6112:Vmn2r60 UTSW 7 42195423 missense probably damaging 1.00
R6149:Vmn2r60 UTSW 7 42136976 missense probably damaging 1.00
R6170:Vmn2r60 UTSW 7 42135621 missense possibly damaging 0.94
R6383:Vmn2r60 UTSW 7 42116471 start codon destroyed probably null 0.04
R6811:Vmn2r60 UTSW 7 42194886 missense probably damaging 1.00
R6876:Vmn2r60 UTSW 7 42135663 missense probably null 0.54
R6997:Vmn2r60 UTSW 7 42142292 missense probably benign 0.00
R7040:Vmn2r60 UTSW 7 42142242 missense probably benign 0.00
R7116:Vmn2r60 UTSW 7 42137063 missense probably benign 0.00
R7128:Vmn2r60 UTSW 7 42195112 missense probably damaging 0.96
R7232:Vmn2r60 UTSW 7 42136742 missense possibly damaging 0.83
R7296:Vmn2r60 UTSW 7 42136402 missense probably benign 0.01
R7376:Vmn2r60 UTSW 7 42195207 missense probably damaging 1.00
R7526:Vmn2r60 UTSW 7 42195734 frame shift probably null
R7527:Vmn2r60 UTSW 7 42195734 frame shift probably null
R7528:Vmn2r60 UTSW 7 42195734 frame shift probably null
R7529:Vmn2r60 UTSW 7 42195734 frame shift probably null
X0023:Vmn2r60 UTSW 7 42141114 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACACTAGGATTTTGTCTGATGCC -3'
(R):5'- ACCCAGACTTTCCATGTCAC -3'

Sequencing Primer
(F):5'- GTCTGATGCCAATGTATTTTGTTATC -3'
(R):5'- CAGACTTTCCATGTCACTAACAGTTG -3'
Posted On2015-04-06