Incidental Mutation 'R3872:Scfd1'
ID276633
Institutional Source Beutler Lab
Gene Symbol Scfd1
Ensembl Gene ENSMUSG00000020952
Gene NameSec1 family domain containing 1
Synonyms3110021P21Rik, RA410, STXBP1L2
MMRRC Submission 040790-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R3872 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location51377510-51450101 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51392196 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 147 (Y147C)
Ref Sequence ENSEMBL: ENSMUSP00000151347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021335] [ENSMUST00000219434]
Predicted Effect probably damaging
Transcript: ENSMUST00000021335
AA Change: Y147C

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021335
Gene: ENSMUSG00000020952
AA Change: Y147C

DomainStartEndE-ValueType
Pfam:Sec1 41 632 1.6e-109 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218131
Predicted Effect probably damaging
Transcript: ENSMUST00000219434
AA Change: Y147C

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219799
Meta Mutation Damage Score 0.9585 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk T C 11: 120,010,219 E1117G possibly damaging Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Baz2a T A 10: 128,124,110 M1419K probably damaging Het
BC055324 A T 1: 163,986,964 S137T probably damaging Het
Bhmt-ps1 T C 4: 26,369,201 noncoding transcript Het
Cabcoco1 T C 10: 68,516,278 Y68C probably damaging Het
Car12 C A 9: 66,717,552 probably benign Het
Cic T C 7: 25,271,699 V285A possibly damaging Het
Col19a1 A G 1: 24,575,327 probably benign Het
Col6a4 T C 9: 106,013,659 N1812S possibly damaging Het
Cry1 T C 10: 85,133,160 probably null Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dlx5 G T 6: 6,878,209 P274T probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dnah5 A G 15: 28,411,510 K3675R possibly damaging Het
Dpp6 A G 5: 27,721,058 Y710C probably damaging Het
Dsc3 C A 18: 19,971,508 K587N probably damaging Het
Epcam C A 17: 87,639,926 T36K possibly damaging Het
Epha2 T C 4: 141,308,405 W51R probably damaging Het
Eya4 A T 10: 23,155,972 I251N probably damaging Het
Fbxo21 G A 5: 118,000,329 V447I possibly damaging Het
Frg2f1 T A 4: 119,530,958 T115S possibly damaging Het
Gm8332 T C 12: 88,249,706 D132G unknown Het
Hecw2 A T 1: 53,832,757 probably benign Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Iqca A T 1: 90,089,481 Y411N probably damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Klhl1 A G 14: 96,518,179 F47L probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Krt34 T C 11: 100,041,417 H27R probably benign Het
Mia3 T C 1: 183,356,998 E791G probably benign Het
Mroh2b A T 15: 4,925,061 K669* probably null Het
Msmo1 C T 8: 64,722,463 probably null Het
Muc6 T C 7: 141,640,600 T1387A probably benign Het
Myo1g C T 11: 6,514,886 V463I possibly damaging Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Pde10a C A 17: 8,757,091 T16K possibly damaging Het
Pfas T C 11: 69,000,263 T310A probably damaging Het
Phb2 G A 6: 124,716,431 probably null Het
Plin3 A G 17: 56,284,181 S200P probably damaging Het
Plxna1 C A 6: 89,332,692 E1087* probably null Het
Rnf17 G T 14: 56,475,413 R779L possibly damaging Het
Sacs C T 14: 61,148,068 T6M probably benign Het
Sept1 T C 7: 127,215,275 probably benign Het
Sept5 A G 16: 18,622,973 L344P probably damaging Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Slc35f1 A G 10: 53,021,910 D139G possibly damaging Het
Sod3 A G 5: 52,368,289 Y110C probably damaging Het
Stk35 T C 2: 129,810,575 V332A possibly damaging Het
Tacc2 C T 7: 130,622,422 T279M probably benign Het
Tdo2 T C 3: 81,968,086 E187G probably benign Het
Tmem150b A T 7: 4,724,361 Y48* probably null Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r60 C T 7: 42,136,454 S227L probably benign Het
Vps33a C T 5: 123,531,192 V549I probably benign Het
Zfp788 T A 7: 41,649,444 Y449* probably null Het
Other mutations in Scfd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Scfd1 APN 12 51427869 missense probably benign 0.01
IGL00640:Scfd1 APN 12 51389315 missense probably benign 0.12
IGL01481:Scfd1 APN 12 51384120 missense probably damaging 0.99
IGL01585:Scfd1 APN 12 51415553 missense probably damaging 1.00
IGL01862:Scfd1 APN 12 51445711 missense probably damaging 1.00
IGL02000:Scfd1 APN 12 51414117 missense probably benign 0.03
IGL02226:Scfd1 APN 12 51389381 splice site probably benign
IGL02327:Scfd1 APN 12 51389317 missense possibly damaging 0.81
IGL02503:Scfd1 APN 12 51422921 missense possibly damaging 0.90
IGL02585:Scfd1 APN 12 51387107 missense probably damaging 0.97
IGL02732:Scfd1 APN 12 51422973 missense probably benign 0.01
R0671:Scfd1 UTSW 12 51412628 missense probably benign 0.01
R0707:Scfd1 UTSW 12 51412577 missense probably damaging 0.98
R1467:Scfd1 UTSW 12 51431498 missense possibly damaging 0.49
R1467:Scfd1 UTSW 12 51431498 missense possibly damaging 0.49
R1962:Scfd1 UTSW 12 51422986 missense probably benign 0.00
R2173:Scfd1 UTSW 12 51387079 missense probably benign 0.22
R2249:Scfd1 UTSW 12 51415516 missense possibly damaging 0.48
R4080:Scfd1 UTSW 12 51431519 missense probably benign
R4356:Scfd1 UTSW 12 51439285 missense probably benign 0.00
R4841:Scfd1 UTSW 12 51389326 missense probably damaging 0.96
R4842:Scfd1 UTSW 12 51389326 missense probably damaging 0.96
R4909:Scfd1 UTSW 12 51390412 missense probably benign 0.00
R5004:Scfd1 UTSW 12 51444994 missense probably benign 0.03
R5275:Scfd1 UTSW 12 51415589 missense probably benign 0.19
R5494:Scfd1 UTSW 12 51396739 splice site probably null
R5779:Scfd1 UTSW 12 51431529 missense probably benign
R6000:Scfd1 UTSW 12 51445674 missense possibly damaging 0.55
R6017:Scfd1 UTSW 12 51445678 missense probably damaging 1.00
R6522:Scfd1 UTSW 12 51431541 missense probably benign 0.04
R6954:Scfd1 UTSW 12 51427946 critical splice donor site probably null
R7748:Scfd1 UTSW 12 51389357 missense probably benign 0.21
RF007:Scfd1 UTSW 12 51422973 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTAGTTATCCTGCTACTTGGC -3'
(R):5'- CAGAGAGCTGGTACTTAACTGAATTAC -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- GCTGGTACTTAACTGAATTACAAACC -3'
Posted On2015-04-06