Incidental Mutation 'R3872:Sept5'
ID276640
Institutional Source Beutler Lab
Gene Symbol Sept5
Ensembl Gene ENSMUSG00000072214
Gene Nameseptin 5
SynonymsCdcrel1, Pnutl1
MMRRC Submission 040790-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.381) question?
Stock #R3872 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location18620502-18629954 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18622973 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 344 (L344P)
Ref Sequence ENSEMBL: ENSMUSP00000156292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051160] [ENSMUST00000096987] [ENSMUST00000167388] [ENSMUST00000231244] [ENSMUST00000231335] [ENSMUST00000231622] [ENSMUST00000231956] [ENSMUST00000232653]
Predicted Effect probably benign
Transcript: ENSMUST00000051160
SMART Domains Protein: ENSMUSP00000059270
Gene: ENSMUSG00000050761

DomainStartEndE-ValueType
low complexity region 7 32 N/A INTRINSIC
LRRNT 33 67 4.14e-11 SMART
low complexity region 75 94 N/A INTRINSIC
LRRCT 97 150 4.88e-14 SMART
transmembrane domain 159 181 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000096987
AA Change: L332P

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000094750
Gene: ENSMUSG00000072214
AA Change: L332P

DomainStartEndE-ValueType
Pfam:Septin 41 321 1.2e-127 PFAM
Pfam:MMR_HSR1 46 190 5.1e-7 PFAM
low complexity region 355 369 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167388
SMART Domains Protein: ENSMUSP00000126292
Gene: ENSMUSG00000050761

DomainStartEndE-ValueType
LRRNT 25 59 4.14e-11 SMART
low complexity region 67 86 N/A INTRINSIC
LRRCT 89 142 4.88e-14 SMART
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231246
Predicted Effect possibly damaging
Transcript: ENSMUST00000231335
AA Change: L341P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231400
Predicted Effect probably benign
Transcript: ENSMUST00000231622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231642
Predicted Effect probably damaging
Transcript: ENSMUST00000231956
AA Change: L344P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232152
Predicted Effect possibly damaging
Transcript: ENSMUST00000232653
AA Change: L341P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.1002 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene show no gross phenotypic changes. Partial defects in synaptic transmission is reported for one allele, and platelet secretion and modest behavioral defects reported for a different allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk T C 11: 120,010,219 E1117G possibly damaging Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Baz2a T A 10: 128,124,110 M1419K probably damaging Het
BC055324 A T 1: 163,986,964 S137T probably damaging Het
Bhmt-ps1 T C 4: 26,369,201 noncoding transcript Het
Cabcoco1 T C 10: 68,516,278 Y68C probably damaging Het
Car12 C A 9: 66,717,552 probably benign Het
Cic T C 7: 25,271,699 V285A possibly damaging Het
Col19a1 A G 1: 24,575,327 probably benign Het
Col6a4 T C 9: 106,013,659 N1812S possibly damaging Het
Cry1 T C 10: 85,133,160 probably null Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dlx5 G T 6: 6,878,209 P274T probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dnah5 A G 15: 28,411,510 K3675R possibly damaging Het
Dpp6 A G 5: 27,721,058 Y710C probably damaging Het
Dsc3 C A 18: 19,971,508 K587N probably damaging Het
Epcam C A 17: 87,639,926 T36K possibly damaging Het
Epha2 T C 4: 141,308,405 W51R probably damaging Het
Eya4 A T 10: 23,155,972 I251N probably damaging Het
Fbxo21 G A 5: 118,000,329 V447I possibly damaging Het
Frg2f1 T A 4: 119,530,958 T115S possibly damaging Het
Gm8332 T C 12: 88,249,706 D132G unknown Het
Hecw2 A T 1: 53,832,757 probably benign Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Iqca A T 1: 90,089,481 Y411N probably damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Klhl1 A G 14: 96,518,179 F47L probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Krt34 T C 11: 100,041,417 H27R probably benign Het
Mia3 T C 1: 183,356,998 E791G probably benign Het
Mroh2b A T 15: 4,925,061 K669* probably null Het
Msmo1 C T 8: 64,722,463 probably null Het
Muc6 T C 7: 141,640,600 T1387A probably benign Het
Myo1g C T 11: 6,514,886 V463I possibly damaging Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Pde10a C A 17: 8,757,091 T16K possibly damaging Het
Pfas T C 11: 69,000,263 T310A probably damaging Het
Phb2 G A 6: 124,716,431 probably null Het
Plin3 A G 17: 56,284,181 S200P probably damaging Het
Plxna1 C A 6: 89,332,692 E1087* probably null Het
Rnf17 G T 14: 56,475,413 R779L possibly damaging Het
Sacs C T 14: 61,148,068 T6M probably benign Het
Scfd1 A G 12: 51,392,196 Y147C probably damaging Het
Sept1 T C 7: 127,215,275 probably benign Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Slc35f1 A G 10: 53,021,910 D139G possibly damaging Het
Sod3 A G 5: 52,368,289 Y110C probably damaging Het
Stk35 T C 2: 129,810,575 V332A possibly damaging Het
Tacc2 C T 7: 130,622,422 T279M probably benign Het
Tdo2 T C 3: 81,968,086 E187G probably benign Het
Tmem150b A T 7: 4,724,361 Y48* probably null Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r60 C T 7: 42,136,454 S227L probably benign Het
Vps33a C T 5: 123,531,192 V549I probably benign Het
Zfp788 T A 7: 41,649,444 Y449* probably null Het
Other mutations in Sept5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Sept5 APN 16 18624930 missense probably damaging 1.00
IGL02124:Sept5 APN 16 18624829 missense probably damaging 0.98
IGL02211:Sept5 APN 16 18624879 missense probably damaging 1.00
IGL02934:Sept5 APN 16 18629831 missense probably damaging 0.99
R0518:Sept5 UTSW 16 18624897 missense probably benign 0.02
R0521:Sept5 UTSW 16 18624897 missense probably benign 0.02
R0627:Sept5 UTSW 16 18625365 missense possibly damaging 0.90
R0746:Sept5 UTSW 16 18623225 missense probably damaging 1.00
R0891:Sept5 UTSW 16 18624845 missense probably damaging 1.00
R1037:Sept5 UTSW 16 18623094 splice site probably benign
R1850:Sept5 UTSW 16 18625210 missense probably damaging 1.00
R2044:Sept5 UTSW 16 18623012 missense probably benign 0.10
R4498:Sept5 UTSW 16 18623392 missense probably damaging 1.00
R5503:Sept5 UTSW 16 18623368 missense probably benign 0.00
R5963:Sept5 UTSW 16 18624212 splice site probably null
R6286:Sept5 UTSW 16 18623377 missense probably damaging 0.99
R7014:Sept5 UTSW 16 18624909 missense probably damaging 1.00
R7909:Sept5 UTSW 16 18624622 missense probably damaging 1.00
R8708:Sept5 UTSW 16 18624872 missense probably benign 0.01
R8888:Sept5 UTSW 16 18623111 missense possibly damaging 0.81
R8895:Sept5 UTSW 16 18623111 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ATCTCCTGCATGCGCCTTAG -3'
(R):5'- CGACCTCAAAGATGTGACGTG -3'

Sequencing Primer
(F):5'- CATGCGCCTTAGCTGGTG -3'
(R):5'- GACGTGCACTATGAGAACTACCG -3'
Posted On2015-04-06