Incidental Mutation 'R3873:Olfr1310'
ID276652
Institutional Source Beutler Lab
Gene Symbol Olfr1310
Ensembl Gene ENSMUSG00000108827
Gene Nameolfactory receptor 1310
SynonymsGA_x6K02T2Q125-73056609-73055671, MOR245-3
MMRRC Submission 040791-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock #R3873 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location112004574-112012708 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112008323 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 288 (T288A)
Ref Sequence ENSEMBL: ENSMUSP00000149701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000207169] [ENSMUST00000213559]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099602
AA Change: T288A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097197
Gene: ENSMUSG00000074949
AA Change: T288A

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 7.7e-41 PFAM
Pfam:7TM_GPCR_Srsx 35 301 3.3e-8 PFAM
Pfam:7tm_1 41 287 5.9e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207169
AA Change: T288A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213559
AA Change: T288A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.5308 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,737,623 I130F probably damaging Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Acaca A G 11: 84,312,721 probably benign Het
Adam5 T C 8: 24,815,109 T110A probably benign Het
Agtpbp1 T C 13: 59,460,596 M175V possibly damaging Het
Akt1 T C 12: 112,656,533 N367S probably benign Het
Ankrd61 T A 5: 143,891,828 T67S probably damaging Het
Arl8a T C 1: 135,152,872 probably null Het
Arvcf G A 16: 18,403,033 R736Q probably damaging Het
Baz2a T A 10: 128,124,110 M1419K probably damaging Het
Cep295 A T 9: 15,333,365 V1265E probably damaging Het
Cyp2c29 A G 19: 39,329,144 D397G probably damaging Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dst A G 1: 34,289,620 T4590A probably damaging Het
Fscb G T 12: 64,473,132 P520Q unknown Het
Gli1 T A 10: 127,331,356 N676I probably damaging Het
Gm8332 T C 12: 88,249,706 D132G unknown Het
Hspg2 T C 4: 137,539,349 I1916T probably damaging Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Il7 A T 3: 7,604,164 V4D probably damaging Het
Itgae T A 11: 73,113,616 I243N probably damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Klhl13 T C X: 23,285,176 D21G probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Ly6g6e T C 17: 35,077,183 V10A probably benign Het
Morc3 G A 16: 93,862,436 V411I probably damaging Het
Mrpl32 G T 13: 14,613,045 probably benign Het
Ncald G A 15: 37,397,253 A61V probably damaging Het
Nek2 T C 1: 191,827,208 V275A probably benign Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1022 T A 2: 85,868,962 Y123* probably null Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Pgam5 T C 5: 110,265,599 Y210C probably damaging Het
Phf5a T C 15: 81,870,427 N50D probably benign Het
Prl7d1 A G 13: 27,716,668 M1T probably null Het
Sacs A G 14: 61,192,286 K595R possibly damaging Het
Scyl3 A G 1: 163,950,637 N448S probably benign Het
Serpinb9g A T 13: 33,486,535 D2V probably benign Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Smg1 T C 7: 118,154,662 probably benign Het
Taar1 T C 10: 23,920,584 L60P probably damaging Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Ubr4 T C 4: 139,423,990 V623A probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vipr2 T C 12: 116,136,104 probably benign Het
Vmn2r16 T C 5: 109,340,311 M350T probably benign Het
Vmn2r22 T C 6: 123,637,380 E417G possibly damaging Het
Vmn2r9 C A 5: 108,847,835 V316F probably benign Het
Zfp53 C T 17: 21,508,631 P309S probably damaging Het
Other mutations in Olfr1310
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01947:Olfr1310 APN 2 112009016 missense possibly damaging 0.86
IGL02700:Olfr1310 APN 2 112008691 missense probably benign 0.04
IGL03008:Olfr1310 APN 2 112008523 missense possibly damaging 0.95
IGL03121:Olfr1310 APN 2 112008608 missense probably benign 0.02
R0025:Olfr1310 UTSW 2 112009020 missense probably damaging 0.98
R1624:Olfr1310 UTSW 2 112008532 missense probably damaging 1.00
R1851:Olfr1310 UTSW 2 112008691 missense probably benign 0.04
R3872:Olfr1310 UTSW 2 112008323 missense possibly damaging 0.95
R3874:Olfr1310 UTSW 2 112008323 missense possibly damaging 0.95
R4651:Olfr1310 UTSW 2 112008250 missense probably damaging 1.00
R4652:Olfr1310 UTSW 2 112008250 missense probably damaging 1.00
R4834:Olfr1310 UTSW 2 112008931 missense probably damaging 1.00
R5076:Olfr1310 UTSW 2 112008592 missense probably damaging 0.99
R7262:Olfr1310 UTSW 2 112008557 missense probably damaging 1.00
R7339:Olfr1310 UTSW 2 112008475 missense probably damaging 1.00
R7657:Olfr1310 UTSW 2 112008748 missense probably benign 0.02
R7798:Olfr1310 UTSW 2 112008272 missense probably benign
R7875:Olfr1310 UTSW 2 112008847 missense probably benign 0.32
R7958:Olfr1310 UTSW 2 112008847 missense probably benign 0.32
X0027:Olfr1310 UTSW 2 112008824 missense probably damaging 1.00
Z1176:Olfr1310 UTSW 2 112008457 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTAGCTGGTAATTTCACTCTAG -3'
(R):5'- GGTAGTTTAGGTAAGGCCCTCTC -3'

Sequencing Primer
(F):5'- AGCTGGTAATTTCACTCTAGTTTTG -3'
(R):5'- AGGTAAGGCCCTCTCCACTTTG -3'
Posted On2015-04-06