Incidental Mutation 'R3873:Fscb'
ID276681
Institutional Source Beutler Lab
Gene Symbol Fscb
Ensembl Gene ENSMUSG00000043060
Gene Namefibrous sheath CABYR binding protein
SynonymsEG623046
MMRRC Submission 040791-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R3873 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location64471330-64474690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 64473132 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 520 (P520Q)
Ref Sequence ENSEMBL: ENSMUSP00000051554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059833]
Predicted Effect unknown
Transcript: ENSMUST00000059833
AA Change: P520Q
SMART Domains Protein: ENSMUSP00000051554
Gene: ENSMUSG00000043060
AA Change: P520Q

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
internal_repeat_1 295 465 2.4e-7 PROSPERO
low complexity region 483 501 N/A INTRINSIC
low complexity region 510 547 N/A INTRINSIC
low complexity region 558 595 N/A INTRINSIC
low complexity region 599 622 N/A INTRINSIC
low complexity region 641 661 N/A INTRINSIC
low complexity region 673 708 N/A INTRINSIC
low complexity region 721 730 N/A INTRINSIC
internal_repeat_1 736 895 2.4e-7 PROSPERO
internal_repeat_2 751 871 6.17e-6 PROSPERO
low complexity region 899 916 N/A INTRINSIC
internal_repeat_2 919 1046 6.17e-6 PROSPERO
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,737,623 I130F probably damaging Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Acaca A G 11: 84,312,721 probably benign Het
Adam5 T C 8: 24,815,109 T110A probably benign Het
Agtpbp1 T C 13: 59,460,596 M175V possibly damaging Het
Akt1 T C 12: 112,656,533 N367S probably benign Het
Ankrd61 T A 5: 143,891,828 T67S probably damaging Het
Arl8a T C 1: 135,152,872 probably null Het
Arvcf G A 16: 18,403,033 R736Q probably damaging Het
Baz2a T A 10: 128,124,110 M1419K probably damaging Het
Cep295 A T 9: 15,333,365 V1265E probably damaging Het
Cyp2c29 A G 19: 39,329,144 D397G probably damaging Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dst A G 1: 34,289,620 T4590A probably damaging Het
Gli1 T A 10: 127,331,356 N676I probably damaging Het
Gm8332 T C 12: 88,249,706 D132G unknown Het
Hspg2 T C 4: 137,539,349 I1916T probably damaging Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Il7 A T 3: 7,604,164 V4D probably damaging Het
Itgae T A 11: 73,113,616 I243N probably damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Klhl13 T C X: 23,285,176 D21G probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Ly6g6e T C 17: 35,077,183 V10A probably benign Het
Morc3 G A 16: 93,862,436 V411I probably damaging Het
Mrpl32 G T 13: 14,613,045 probably benign Het
Ncald G A 15: 37,397,253 A61V probably damaging Het
Nek2 T C 1: 191,827,208 V275A probably benign Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1022 T A 2: 85,868,962 Y123* probably null Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Pgam5 T C 5: 110,265,599 Y210C probably damaging Het
Phf5a T C 15: 81,870,427 N50D probably benign Het
Prl7d1 A G 13: 27,716,668 M1T probably null Het
Sacs A G 14: 61,192,286 K595R possibly damaging Het
Scyl3 A G 1: 163,950,637 N448S probably benign Het
Serpinb9g A T 13: 33,486,535 D2V probably benign Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Smg1 T C 7: 118,154,662 probably benign Het
Taar1 T C 10: 23,920,584 L60P probably damaging Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Ubr4 T C 4: 139,423,990 V623A probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vipr2 T C 12: 116,136,104 probably benign Het
Vmn2r16 T C 5: 109,340,311 M350T probably benign Het
Vmn2r22 T C 6: 123,637,380 E417G possibly damaging Het
Vmn2r9 C A 5: 108,847,835 V316F probably benign Het
Zfp53 C T 17: 21,508,631 P309S probably damaging Het
Other mutations in Fscb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Fscb APN 12 64473381 missense possibly damaging 0.46
IGL01099:Fscb APN 12 64472101 missense unknown
IGL01394:Fscb APN 12 64473804 missense possibly damaging 0.83
IGL02570:Fscb APN 12 64472178 missense unknown
IGL02974:Fscb APN 12 64471525 missense unknown
IGL03150:Fscb APN 12 64472430 missense unknown
IGL03407:Fscb APN 12 64473495 missense probably damaging 0.96
FR4548:Fscb UTSW 12 64472563 missense unknown
FR4548:Fscb UTSW 12 64472565 missense unknown
R0056:Fscb UTSW 12 64474247 missense possibly damaging 0.66
R0490:Fscb UTSW 12 64472887 missense unknown
R0492:Fscb UTSW 12 64473518 missense possibly damaging 0.46
R0702:Fscb UTSW 12 64472001 missense unknown
R1017:Fscb UTSW 12 64473468 missense probably benign 0.07
R1672:Fscb UTSW 12 64471518 missense unknown
R1737:Fscb UTSW 12 64474581 missense possibly damaging 0.83
R1795:Fscb UTSW 12 64474401 missense probably damaging 0.99
R1969:Fscb UTSW 12 64473234 missense unknown
R1984:Fscb UTSW 12 64474683 missense unknown
R2164:Fscb UTSW 12 64473793 missense probably damaging 0.96
R2213:Fscb UTSW 12 64474116 missense possibly damaging 0.84
R2874:Fscb UTSW 12 64473436 missense probably benign 0.00
R2878:Fscb UTSW 12 64472574 missense unknown
R4734:Fscb UTSW 12 64474470 missense possibly damaging 0.82
R4773:Fscb UTSW 12 64473690 missense probably damaging 1.00
R4940:Fscb UTSW 12 64473814 missense probably benign 0.03
R4981:Fscb UTSW 12 64473619 missense possibly damaging 0.46
R5105:Fscb UTSW 12 64473336 missense possibly damaging 0.82
R5845:Fscb UTSW 12 64472784 missense unknown
R6049:Fscb UTSW 12 64474320 missense possibly damaging 0.66
R6743:Fscb UTSW 12 64471573 missense unknown
R7026:Fscb UTSW 12 64471617 missense unknown
R7285:Fscb UTSW 12 64471549 missense unknown
R7372:Fscb UTSW 12 64471824 missense unknown
R7400:Fscb UTSW 12 64471617 missense unknown
R7563:Fscb UTSW 12 64473285 missense possibly damaging 0.82
R7748:Fscb UTSW 12 64474407 missense probably benign 0.04
R7759:Fscb UTSW 12 64474092 missense probably benign 0.03
R8026:Fscb UTSW 12 64474275 missense probably benign 0.12
R8070:Fscb UTSW 12 64474608 missense probably benign 0.04
RF011:Fscb UTSW 12 64472994 small deletion probably benign
RF019:Fscb UTSW 12 64472596 small insertion probably benign
RF038:Fscb UTSW 12 64472569 small insertion probably benign
Z1176:Fscb UTSW 12 64472930 missense unknown
Z1177:Fscb UTSW 12 64472628 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGTAGAACTTCTGCAGGGACC -3'
(R):5'- AGTTCAGCCTCCATCAGCAG -3'

Sequencing Primer
(F):5'- GAACTTCTGCAGGGACCTCCTC -3'
(R):5'- AGAAGTGGCTCCTTCAGAAGTTC -3'
Posted On2015-04-06