Incidental Mutation 'R3873:Phf5a'
ID276692
Institutional Source Beutler Lab
Gene Symbol Phf5a
Ensembl Gene ENSMUSG00000061360
Gene NamePHD finger protein 5A
Synonyms
MMRRC Submission 040791-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3873 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location81864520-81871911 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81870427 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 50 (N50D)
Ref Sequence ENSEMBL: ENSMUSP00000023117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023116] [ENSMUST00000023117] [ENSMUST00000135198] [ENSMUST00000157003] [ENSMUST00000229068] [ENSMUST00000231091]
Predicted Effect probably benign
Transcript: ENSMUST00000023116
SMART Domains Protein: ENSMUSP00000023116
Gene: ENSMUSG00000022477

DomainStartEndE-ValueType
Pfam:Aconitase 65 503 2.2e-160 PFAM
Pfam:Aconitase_C 582 712 5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000023117
AA Change: N50D

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000023117
Gene: ENSMUSG00000061360
AA Change: N50D

DomainStartEndE-ValueType
Pfam:PHF5 1 104 1.8e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135198
Predicted Effect probably benign
Transcript: ENSMUST00000157003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160415
Predicted Effect probably benign
Transcript: ENSMUST00000229068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230134
Predicted Effect probably benign
Transcript: ENSMUST00000231091
Meta Mutation Damage Score 0.0650 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence-independent manner and may anchor the U2 snRNP to the pre-mRNA. The protein encoded by this gene contains a PHD-finger-like domain that is flanked by highly basic N- and C-termini. This protein belongs to the PHD-finger superfamily and may act as a chromatin-associated protein. This gene has several pseudogenes on different chromosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit embryonic lethality at E6. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,737,623 I130F probably damaging Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Acaca A G 11: 84,312,721 probably benign Het
Adam5 T C 8: 24,815,109 T110A probably benign Het
Agtpbp1 T C 13: 59,460,596 M175V possibly damaging Het
Akt1 T C 12: 112,656,533 N367S probably benign Het
Ankrd61 T A 5: 143,891,828 T67S probably damaging Het
Arl8a T C 1: 135,152,872 probably null Het
Arvcf G A 16: 18,403,033 R736Q probably damaging Het
Baz2a T A 10: 128,124,110 M1419K probably damaging Het
Cep295 A T 9: 15,333,365 V1265E probably damaging Het
Cyp2c29 A G 19: 39,329,144 D397G probably damaging Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dst A G 1: 34,289,620 T4590A probably damaging Het
Fscb G T 12: 64,473,132 P520Q unknown Het
Gli1 T A 10: 127,331,356 N676I probably damaging Het
Gm8332 T C 12: 88,249,706 D132G unknown Het
Hspg2 T C 4: 137,539,349 I1916T probably damaging Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Il7 A T 3: 7,604,164 V4D probably damaging Het
Itgae T A 11: 73,113,616 I243N probably damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Klhl13 T C X: 23,285,176 D21G probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Ly6g6e T C 17: 35,077,183 V10A probably benign Het
Morc3 G A 16: 93,862,436 V411I probably damaging Het
Mrpl32 G T 13: 14,613,045 probably benign Het
Ncald G A 15: 37,397,253 A61V probably damaging Het
Nek2 T C 1: 191,827,208 V275A probably benign Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1022 T A 2: 85,868,962 Y123* probably null Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Pgam5 T C 5: 110,265,599 Y210C probably damaging Het
Prl7d1 A G 13: 27,716,668 M1T probably null Het
Sacs A G 14: 61,192,286 K595R possibly damaging Het
Scyl3 A G 1: 163,950,637 N448S probably benign Het
Serpinb9g A T 13: 33,486,535 D2V probably benign Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Smg1 T C 7: 118,154,662 probably benign Het
Taar1 T C 10: 23,920,584 L60P probably damaging Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Ubr4 T C 4: 139,423,990 V623A probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vipr2 T C 12: 116,136,104 probably benign Het
Vmn2r16 T C 5: 109,340,311 M350T probably benign Het
Vmn2r22 T C 6: 123,637,380 E417G possibly damaging Het
Vmn2r9 C A 5: 108,847,835 V316F probably benign Het
Zfp53 C T 17: 21,508,631 P309S probably damaging Het
Predicted Primers PCR Primer
(F):5'- GTTTGGCTCACAGGCTTGAAG -3'
(R):5'- TCACTGTCAGAAGGAGACTAGTG -3'

Sequencing Primer
(F):5'- TGGCTCACAGGCTTGAAGAAATTAC -3'
(R):5'- AGACTAGTGATTTCCCGCATAGG -3'
Posted On2015-04-06