Incidental Mutation 'R3873:Cyp2c29'
ID276699
Institutional Source Beutler Lab
Gene Symbol Cyp2c29
Ensembl Gene ENSMUSG00000003053
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 29
SynonymsAh-2, Cyp2c, P450-2C, Ahh-1, AHOHase, AHOH
MMRRC Submission 040791-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R3873 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location39269405-39330713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39329144 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 397 (D397G)
Ref Sequence ENSEMBL: ENSMUSP00000003137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003137] [ENSMUST00000176624] [ENSMUST00000177087]
Predicted Effect probably damaging
Transcript: ENSMUST00000003137
AA Change: D397G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000003137
Gene: ENSMUSG00000003053
AA Change: D397G

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:p450 30 487 5.4e-165 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176624
AA Change: D358G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135863
Gene: ENSMUSG00000003053
AA Change: D358G

DomainStartEndE-ValueType
Pfam:p450 12 448 2.7e-156 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177087
SMART Domains Protein: ENSMUSP00000135839
Gene: ENSMUSG00000003053

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:p450 30 118 8.4e-22 PFAM
Meta Mutation Damage Score 0.7627 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,737,623 I130F probably damaging Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Acaca A G 11: 84,312,721 probably benign Het
Adam5 T C 8: 24,815,109 T110A probably benign Het
Agtpbp1 T C 13: 59,460,596 M175V possibly damaging Het
Akt1 T C 12: 112,656,533 N367S probably benign Het
Ankrd61 T A 5: 143,891,828 T67S probably damaging Het
Arl8a T C 1: 135,152,872 probably null Het
Arvcf G A 16: 18,403,033 R736Q probably damaging Het
Baz2a T A 10: 128,124,110 M1419K probably damaging Het
Cep295 A T 9: 15,333,365 V1265E probably damaging Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dst A G 1: 34,289,620 T4590A probably damaging Het
Fscb G T 12: 64,473,132 P520Q unknown Het
Gli1 T A 10: 127,331,356 N676I probably damaging Het
Gm8332 T C 12: 88,249,706 D132G unknown Het
Hspg2 T C 4: 137,539,349 I1916T probably damaging Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Il7 A T 3: 7,604,164 V4D probably damaging Het
Itgae T A 11: 73,113,616 I243N probably damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Klhl13 T C X: 23,285,176 D21G probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Ly6g6e T C 17: 35,077,183 V10A probably benign Het
Morc3 G A 16: 93,862,436 V411I probably damaging Het
Mrpl32 G T 13: 14,613,045 probably benign Het
Ncald G A 15: 37,397,253 A61V probably damaging Het
Nek2 T C 1: 191,827,208 V275A probably benign Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1022 T A 2: 85,868,962 Y123* probably null Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Pgam5 T C 5: 110,265,599 Y210C probably damaging Het
Phf5a T C 15: 81,870,427 N50D probably benign Het
Prl7d1 A G 13: 27,716,668 M1T probably null Het
Sacs A G 14: 61,192,286 K595R possibly damaging Het
Scyl3 A G 1: 163,950,637 N448S probably benign Het
Serpinb9g A T 13: 33,486,535 D2V probably benign Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Smg1 T C 7: 118,154,662 probably benign Het
Taar1 T C 10: 23,920,584 L60P probably damaging Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Ubr4 T C 4: 139,423,990 V623A probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vipr2 T C 12: 116,136,104 probably benign Het
Vmn2r16 T C 5: 109,340,311 M350T probably benign Het
Vmn2r22 T C 6: 123,637,380 E417G possibly damaging Het
Vmn2r9 C A 5: 108,847,835 V316F probably benign Het
Zfp53 C T 17: 21,508,631 P309S probably damaging Het
Other mutations in Cyp2c29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Cyp2c29 APN 19 39321699 splice site probably benign
IGL00482:Cyp2c29 APN 19 39325023 missense probably damaging 0.97
IGL00694:Cyp2c29 APN 19 39321635 missense possibly damaging 0.64
IGL00836:Cyp2c29 APN 19 39324990 missense probably damaging 0.98
IGL00858:Cyp2c29 APN 19 39307656 missense probably damaging 1.00
IGL01350:Cyp2c29 APN 19 39330327 missense probably damaging 1.00
IGL01455:Cyp2c29 APN 19 39329117 missense possibly damaging 0.89
IGL01718:Cyp2c29 APN 19 39330260 missense possibly damaging 0.48
IGL01977:Cyp2c29 APN 19 39290897 splice site probably benign
IGL01991:Cyp2c29 APN 19 39330315 missense probably damaging 1.00
IGL02097:Cyp2c29 APN 19 39307620 missense probably damaging 1.00
IGL02267:Cyp2c29 APN 19 39330422 missense probably benign 0.19
IGL02451:Cyp2c29 APN 19 39290847 missense possibly damaging 0.66
IGL02452:Cyp2c29 APN 19 39290847 missense possibly damaging 0.66
IGL02548:Cyp2c29 APN 19 39290847 missense possibly damaging 0.66
IGL02549:Cyp2c29 APN 19 39309785 missense possibly damaging 0.48
IGL02938:Cyp2c29 APN 19 39287123 missense probably damaging 0.99
IGL03252:Cyp2c29 APN 19 39287175 missense probably damaging 1.00
IGL03367:Cyp2c29 APN 19 39329215 missense probably damaging 0.97
H8562:Cyp2c29 UTSW 19 39309662 missense probably damaging 1.00
IGL03052:Cyp2c29 UTSW 19 39287218 missense possibly damaging 0.90
R0415:Cyp2c29 UTSW 19 39329095 splice site probably benign
R0504:Cyp2c29 UTSW 19 39309780 missense probably benign 0.29
R0690:Cyp2c29 UTSW 19 39309726 missense probably benign 0.00
R1531:Cyp2c29 UTSW 19 39324968 missense probably damaging 1.00
R1730:Cyp2c29 UTSW 19 39324945 missense possibly damaging 0.79
R1981:Cyp2c29 UTSW 19 39307772 splice site probably null
R2113:Cyp2c29 UTSW 19 39330264 missense probably damaging 1.00
R2220:Cyp2c29 UTSW 19 39287232 missense probably benign 0.09
R4424:Cyp2c29 UTSW 19 39287176 missense probably damaging 0.98
R4451:Cyp2c29 UTSW 19 39290826 missense probably damaging 0.99
R4803:Cyp2c29 UTSW 19 39324995 missense probably benign 0.01
R5288:Cyp2c29 UTSW 19 39330372 missense probably damaging 0.96
R5474:Cyp2c29 UTSW 19 39324992 missense probably damaging 1.00
R5475:Cyp2c29 UTSW 19 39330287 missense possibly damaging 0.91
R5893:Cyp2c29 UTSW 19 39330389 missense possibly damaging 0.93
R5894:Cyp2c29 UTSW 19 39330389 missense possibly damaging 0.93
R6000:Cyp2c29 UTSW 19 39307606 critical splice acceptor site probably null
R6144:Cyp2c29 UTSW 19 39321609 missense possibly damaging 0.96
R6296:Cyp2c29 UTSW 19 39330261 missense possibly damaging 0.64
R6365:Cyp2c29 UTSW 19 39307754 missense probably damaging 1.00
R6449:Cyp2c29 UTSW 19 39290867 missense probably benign 0.05
R6464:Cyp2c29 UTSW 19 39329225 missense probably damaging 0.96
R6919:Cyp2c29 UTSW 19 39291141 missense probably benign 0.26
R6978:Cyp2c29 UTSW 19 39321663 missense probably damaging 1.00
R7038:Cyp2c29 UTSW 19 39287127 missense probably benign 0.01
R7040:Cyp2c29 UTSW 19 39330337 missense possibly damaging 0.95
R7391:Cyp2c29 UTSW 19 39307767 missense probably null 0.98
X0024:Cyp2c29 UTSW 19 39321599 missense probably benign 0.01
Z1176:Cyp2c29 UTSW 19 39324997 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ACATCAATATGGCTGGCCTC -3'
(R):5'- AGACATGGATAAGCATGCTGC -3'

Sequencing Primer
(F):5'- GGCTGGCCTCAGACTCCTTC -3'
(R):5'- GCTGATTGCATACAAATTGCAAGTC -3'
Posted On2015-04-06