Mutagenetix > Incidental Mutations

Incidental Mutation 'R3874:Sulf1'

276700

Institutional Source

Beutler Lab

Gene Symbol

Sulf1

Ensembl Gene

ENSMUSG00000016918

Gene Name

sulfatase 1

Synonyms

MMRRC Submission

040792-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.535) question?

Stock #

R3874 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12692277-12861192 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 12817412 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 270 (I270T)

Ref Sequence

ENSEMBL: ENSMUSP00000141153 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088585] [ENSMUST00000177608] [ENSMUST00000180062] [ENSMUST00000186051]

AlphaFold

Q8K007

Predicted Effect

possibly damaging
Transcript: ENSMUST00000088585
AA Change: I270T

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000085949
Gene: ENSMUSG00000016918
AA Change: I270T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Sulfatase	43	374	7.7e-59	PFAM
Pfam:Phosphodiest	61	323	9.2e-11	PFAM
low complexity region	512	523	N/A	INTRINSIC
Pfam:DUF3740	533	679	5e-52	PFAM
low complexity region	717	737	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177608
AA Change: I270T

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000137523
Gene: ENSMUSG00000016918
AA Change: I270T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Sulfatase	43	374	7.7e-59	PFAM
low complexity region	512	523	N/A	INTRINSIC
Pfam:DUF3740	534	678	9.7e-52	PFAM
low complexity region	717	737	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000180062
AA Change: I270T

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000136014
Gene: ENSMUSG00000016918
AA Change: I270T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Sulfatase	43	374	7.7e-59	PFAM
Pfam:Phosphodiest	61	323	9.2e-11	PFAM
low complexity region	512	523	N/A	INTRINSIC
Pfam:DUF3740	533	679	5e-52	PFAM
low complexity region	717	737	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000186051
AA Change: I270T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141153
Gene: ENSMUSG00000016918
AA Change: I270T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Sulfatase	43	374	7.4e-56	PFAM
Pfam:Phosphodiest	61	323	9.6e-8	PFAM
low complexity region	512	523	N/A	INTRINSIC
Pfam:DUF3740	533	679	1.1e-48	PFAM
low complexity region	717	737	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187376

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular heparan sulfate endosulfatase. The encoded enzyme selectively removes 6-O-sulfate groups from heparan sulfate chains of heparan sulfate proteoglycans (HSPGs). The enzyme is secreted through the Golgi and is subsequently localized to the cell surface. The expression of this gene may be down-regulated in several types of cancer, including hepatocellular (HCC), ovarian and breast cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a null allele display a slight increase in mortality early in life. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130213A22Rik	C	A	11: 69,121,475	G26*	probably null	Het
Abca5	T	A	11: 110,310,233	Y447F	probably damaging	Het
Acox2	A	G	14: 8,248,061	I407T	probably benign	Het
Adam8	T	C	7: 139,987,607	N408D	probably damaging	Het
Adgre1	A	T	17: 57,401,925	T39S	probably benign	Het
Akap12	G	A	10: 4,357,590	V1467I	probably benign	Het
Arid1b	T	A	17: 5,336,515		probably null	Het
Atp2c2	A	G	8: 119,735,296	I303V	possibly damaging	Het
Bpifc	C	T	10: 85,991,254	V144I	probably benign	Het
C530008M17Rik	A	G	5: 76,840,892	D30G	probably damaging	Het
Camk4	A	G	18: 33,158,854	E189G	possibly damaging	Het
Casz1	A	G	4: 148,939,589		probably benign	Het
Ccdc134	T	C	15: 82,131,442	V41A	possibly damaging	Het
Chrd	A	T	16: 20,738,910	T753S	probably damaging	Het
Cyb561a3	T	C	19: 10,585,371	V125A	probably benign	Het
D630039A03Rik	T	A	4: 57,910,606	T69S	probably benign	Het
Dchs1	A	G	7: 105,761,635	F1687S	probably damaging	Het
Dlgap4	T	C	2: 156,749,347	S818P	probably benign	Het
Dnah2	A	G	11: 69,429,348	I3965T	probably damaging	Het
Dnaic2	G	T	11: 114,732,955	G15W	probably damaging	Het
Dsg1c	A	G	18: 20,277,052	I526V	probably benign	Het
Far2	G	A	6: 148,150,591	E123K	probably benign	Het
Gli1	A	T	10: 127,330,219	V1055E	probably damaging	Het
Hand2	G	T	8: 57,321,976	A24S	probably benign	Het
Helb	T	C	10: 120,106,037	I249V	probably benign	Het
Hspa4l	G	A	3: 40,772,642	V492M	probably damaging	Het
Hspg2	T	C	4: 137,539,349	I1916T	probably damaging	Het
Igfals	G	A	17: 24,881,605	V557I	possibly damaging	Het
Itpa	T	G	2: 130,681,010	S176A	probably damaging	Het
Kcnu1	T	A	8: 25,885,317	L353H	probably damaging	Het
Klhl1	A	G	14: 96,518,179	F47L	probably benign	Het
Klhl13	T	C	X: 23,285,176	D21G	probably benign	Het
Krt26	T	C	11: 99,334,744	K304E	probably damaging	Het
Krt9	C	T	11: 100,190,849	V285I	probably damaging	Het
Mansc1	T	C	6: 134,610,183	R344G	possibly damaging	Het
Mier2	G	T	10: 79,541,797	P439T	possibly damaging	Het
Mppe1	T	A	18: 67,225,886		probably null	Het
Nedd4l	G	A	18: 65,167,535	A243T	probably benign	Het
Notch4	T	A	17: 34,578,069	C934*	probably null	Het
Nsmce3	C	T	7: 64,872,168	D251N	probably damaging	Het
Olfr101	T	A	17: 37,299,979	T148S	probably benign	Het
Olfr1156	T	A	2: 87,949,530	R234S	probably damaging	Het
Olfr1310	T	C	2: 112,008,323	T288A	possibly damaging	Het
Olfr139	A	G	11: 74,044,699	C192R	probably damaging	Het
Olfr517	C	T	7: 108,869,128	V9M	probably damaging	Het
Olfr937	A	G	9: 39,060,174	I164T	probably benign	Het
Pdzd7	T	C	19: 45,045,628	T6A	probably benign	Het
Picalm	T	A	7: 90,189,219	F493Y	probably damaging	Het
Prl7d1	A	G	13: 27,716,668	M1T	probably null	Het
Prl8a1	T	C	13: 27,575,458	K199E	possibly damaging	Het
Rims1	C	T	1: 22,428,489	R764H	probably damaging	Het
Rnf17	G	T	14: 56,475,413	R779L	possibly damaging	Het
Rufy2	T	C	10: 62,998,137	L294P	probably damaging	Het
Sgsh	A	G	11: 119,350,947	L111P	probably damaging	Het
Slc22a30	G	T	19: 8,336,849	T491K	probably benign	Het
Slc35b3	T	C	13: 38,943,068	N20D	possibly damaging	Het
Slc5a4a	T	C	10: 76,181,655	F429L	probably benign	Het
Tmem51	T	C	4: 142,031,748	T230A	probably damaging	Het
Tnc	T	A	4: 64,008,710	I860F	probably damaging	Het
Trh	A	T	6: 92,243,698	V61E	possibly damaging	Het
Ttn	T	G	2: 76,754,099	T22222P	probably damaging	Het
Uroc1	A	T	6: 90,361,512	K652*	probably null	Het
Usp34	C	T	11: 23,489,033	P3532S	possibly damaging	Het
Vmn2r120	A	T	17: 57,524,954	F278L	probably benign	Het
Vmn2r7	A	G	3: 64,719,611	F86L	possibly damaging	Het
Vmn2r87	A	T	10: 130,479,987	I70K	possibly damaging	Het
Vps13a	C	T	19: 16,744,953	A332T	probably benign	Het
Zfp568	T	A	7: 30,023,396	C589S	probably damaging	Het

Other mutations in Sulf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Sulf1	APN	1	12820463	missense	probably damaging	0.99
IGL00788:Sulf1	APN	1	12848449	missense	probably damaging	0.99
IGL00845:Sulf1	APN	1	12796967	missense	probably damaging	1.00
IGL01606:Sulf1	APN	1	12836204	missense	possibly damaging	0.87
IGL01963:Sulf1	APN	1	12818507	missense	probably damaging	1.00
IGL01968:Sulf1	APN	1	12818451	missense	probably damaging	1.00
IGL02072:Sulf1	APN	1	12848208	missense	probably damaging	1.00
IGL02424:Sulf1	APN	1	12796840	missense	probably benign	0.28
IGL02519:Sulf1	APN	1	12838363	nonsense	probably null
IGL02601:Sulf1	APN	1	12786645	missense	probably damaging	1.00
IGL03066:Sulf1	APN	1	12807944	missense	probably damaging	0.99
IGL03200:Sulf1	APN	1	12786617	nonsense	probably null
PIT4480001:Sulf1	UTSW	1	12859413	missense	probably benign	0.01
PIT4519001:Sulf1	UTSW	1	12848171	missense	probably damaging	1.00
R0083:Sulf1	UTSW	1	12817417	missense	probably damaging	0.99
R0467:Sulf1	UTSW	1	12796920	missense	probably damaging	1.00
R0554:Sulf1	UTSW	1	12805194	missense	probably damaging	1.00
R0626:Sulf1	UTSW	1	12817492	splice site	probably null
R1083:Sulf1	UTSW	1	12836164	frame shift	probably null
R1084:Sulf1	UTSW	1	12836164	frame shift	probably null
R1498:Sulf1	UTSW	1	12848350	missense	probably damaging	1.00
R1523:Sulf1	UTSW	1	12817350	nonsense	probably null
R1854:Sulf1	UTSW	1	12838437	missense	probably benign	0.06
R1942:Sulf1	UTSW	1	12848173	missense	probably damaging	1.00
R1946:Sulf1	UTSW	1	12796907	missense	probably benign	0.04
R1998:Sulf1	UTSW	1	12858834	nonsense	probably null
R2034:Sulf1	UTSW	1	12820421	missense	probably damaging	1.00
R2068:Sulf1	UTSW	1	12840403	missense	probably damaging	1.00
R2113:Sulf1	UTSW	1	12848174	missense	probably damaging	0.99
R2277:Sulf1	UTSW	1	12796794	missense	probably benign	0.41
R3827:Sulf1	UTSW	1	12817432	missense	probably benign
R4488:Sulf1	UTSW	1	12786515	start gained	probably benign
R4619:Sulf1	UTSW	1	12786652	missense	probably damaging	1.00
R4743:Sulf1	UTSW	1	12836293	missense	probably benign	0.04
R4836:Sulf1	UTSW	1	12842686	missense	probably benign	0.02
R4918:Sulf1	UTSW	1	12818496	missense	probably damaging	1.00
R4958:Sulf1	UTSW	1	12796910	missense	probably benign	0.08
R5216:Sulf1	UTSW	1	12796874	missense	probably benign	0.28
R5225:Sulf1	UTSW	1	12841478	missense	probably benign
R5427:Sulf1	UTSW	1	12796912	missense	possibly damaging	0.84
R5450:Sulf1	UTSW	1	12796907	missense	probably benign	0.04
R5909:Sulf1	UTSW	1	12858815	missense	possibly damaging	0.94
R5912:Sulf1	UTSW	1	12786752	unclassified	probably benign
R5966:Sulf1	UTSW	1	12859412	missense	probably benign	0.06
R6339:Sulf1	UTSW	1	12838440	missense	probably damaging	1.00
R6841:Sulf1	UTSW	1	12838434	missense	probably damaging	1.00
R6880:Sulf1	UTSW	1	12842755	missense	probably damaging	1.00
R7110:Sulf1	UTSW	1	12838601	missense	probably damaging	1.00
R7255:Sulf1	UTSW	1	12859008	missense	probably benign	0.00
R7275:Sulf1	UTSW	1	12850965	splice site	probably null
R7386:Sulf1	UTSW	1	12838361	missense	probably benign	0.07
R7611:Sulf1	UTSW	1	12836243	missense	probably benign
R7732:Sulf1	UTSW	1	12842789	missense	probably benign	0.11
R7796:Sulf1	UTSW	1	12858820	missense	probably benign	0.27
R7898:Sulf1	UTSW	1	12805294	missense	probably damaging	1.00
R7984:Sulf1	UTSW	1	12859273	missense	probably benign	0.00
R8003:Sulf1	UTSW	1	12838601	missense	probably damaging	1.00
R8684:Sulf1	UTSW	1	12796780	missense	probably benign	0.06
R8714:Sulf1	UTSW	1	12807917	missense	probably benign	0.07
R8723:Sulf1	UTSW	1	12786687	missense	probably damaging	1.00
R8988:Sulf1	UTSW	1	12836275	missense	probably benign
R9055:Sulf1	UTSW	1	12807963	missense	probably damaging	1.00
R9100:Sulf1	UTSW	1	12807894	missense	probably damaging	1.00
R9288:Sulf1	UTSW	1	12786603	missense	probably benign	0.09
R9358:Sulf1	UTSW	1	12820505	missense	probably damaging	1.00
R9387:Sulf1	UTSW	1	12838554	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TGGGAGAAGAACACTTCAGC -3'
(R):5'- ATGTCATTGAACACACTTGTCTCTC -3'

Sequencing Primer
(F):5'- TCAGCAGTGACTAAATTATCTTTCAG -3'
(R):5'- GAACACACTTGTCTCTCTTAACAG -3'

Posted On

2015-04-06