Mutagenetix > Incidental Mutation

Incidental Mutation 'R3874:Itpa'

276705

Institutional Source

Beutler Lab

Gene Symbol

Itpa

Ensembl Gene

ENSMUSG00000074797

Gene Name

inosine triphosphatase (nucleoside triphosphate pyrophosphatase)

Synonyms

2010016I08Rik, Itp

MMRRC Submission

040792-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3874 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

130667610-130681614 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 130681010 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 176 (S176A)

Ref Sequence

ENSEMBL: ENSMUSP00000099482 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099362] [ENSMUST00000103193]

AlphaFold

Q9D892

Predicted Effect

probably benign
Transcript: ENSMUST00000099362

SMART Domains

Protein: ENSMUSP00000096963
Gene: ENSMUSG00000074796

Domain	Start	End	E-Value	Type
SCOP:d1a3aa_	199	276	5e-5	SMART
Pfam:HCO3_cotransp	308	806	9.7e-153	PFAM
transmembrane domain	827	844	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000103193
AA Change: S176A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099482
Gene: ENSMUSG00000074797
AA Change: S176A

Domain	Start	End	E-Value	Type
Pfam:Ham1p_like	10	188	4.3e-54	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126714

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144945

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156382

Meta Mutation Damage Score

0.9056

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an inosine triphosphate pyrophosphohydrolase. The encoded protein hydrolyzes inosine triphosphate and deoxyinosine triphosphate to the monophosphate nucleotide and diphosphate. This protein, which is a member of the HAM1 NTPase protein family, is found in the cytoplasm and acts as a homodimer. Defects in the encoded protein can result in inosine triphosphate pyrophosphorylase deficiency which causes an accumulation of ITP in red blood cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial perinatal lethality and complete postnatal lethality with postnatal growth retardation, abnormal heart morphology and function, ataxia, and immature hair follicles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130213A22Rik	C	A	11: 69,121,475	G26*	probably null	Het
Abca5	T	A	11: 110,310,233	Y447F	probably damaging	Het
Acox2	A	G	14: 8,248,061	I407T	probably benign	Het
Adam8	T	C	7: 139,987,607	N408D	probably damaging	Het
Adgre1	A	T	17: 57,401,925	T39S	probably benign	Het
Akap12	G	A	10: 4,357,590	V1467I	probably benign	Het
Arid1b	T	A	17: 5,336,515		probably null	Het
Atp2c2	A	G	8: 119,735,296	I303V	possibly damaging	Het
Bpifc	C	T	10: 85,991,254	V144I	probably benign	Het
C530008M17Rik	A	G	5: 76,840,892	D30G	probably damaging	Het
Camk4	A	G	18: 33,158,854	E189G	possibly damaging	Het
Casz1	A	G	4: 148,939,589		probably benign	Het
Ccdc134	T	C	15: 82,131,442	V41A	possibly damaging	Het
Chrd	A	T	16: 20,738,910	T753S	probably damaging	Het
Cyb561a3	T	C	19: 10,585,371	V125A	probably benign	Het
D630039A03Rik	T	A	4: 57,910,606	T69S	probably benign	Het
Dchs1	A	G	7: 105,761,635	F1687S	probably damaging	Het
Dlgap4	T	C	2: 156,749,347	S818P	probably benign	Het
Dnah2	A	G	11: 69,429,348	I3965T	probably damaging	Het
Dnaic2	G	T	11: 114,732,955	G15W	probably damaging	Het
Dsg1c	A	G	18: 20,277,052	I526V	probably benign	Het
Far2	G	A	6: 148,150,591	E123K	probably benign	Het
Gli1	A	T	10: 127,330,219	V1055E	probably damaging	Het
Hand2	G	T	8: 57,321,976	A24S	probably benign	Het
Helb	T	C	10: 120,106,037	I249V	probably benign	Het
Hspa4l	G	A	3: 40,772,642	V492M	probably damaging	Het
Hspg2	T	C	4: 137,539,349	I1916T	probably damaging	Het
Igfals	G	A	17: 24,881,605	V557I	possibly damaging	Het
Kcnu1	T	A	8: 25,885,317	L353H	probably damaging	Het
Klhl1	A	G	14: 96,518,179	F47L	probably benign	Het
Klhl13	T	C	X: 23,285,176	D21G	probably benign	Het
Krt26	T	C	11: 99,334,744	K304E	probably damaging	Het
Krt9	C	T	11: 100,190,849	V285I	probably damaging	Het
Mansc1	T	C	6: 134,610,183	R344G	possibly damaging	Het
Mier2	G	T	10: 79,541,797	P439T	possibly damaging	Het
Mppe1	T	A	18: 67,225,886		probably null	Het
Nedd4l	G	A	18: 65,167,535	A243T	probably benign	Het
Notch4	T	A	17: 34,578,069	C934*	probably null	Het
Nsmce3	C	T	7: 64,872,168	D251N	probably damaging	Het
Olfr101	T	A	17: 37,299,979	T148S	probably benign	Het
Olfr1156	T	A	2: 87,949,530	R234S	probably damaging	Het
Olfr1310	T	C	2: 112,008,323	T288A	possibly damaging	Het
Olfr139	A	G	11: 74,044,699	C192R	probably damaging	Het
Olfr517	C	T	7: 108,869,128	V9M	probably damaging	Het
Olfr937	A	G	9: 39,060,174	I164T	probably benign	Het
Pdzd7	T	C	19: 45,045,628	T6A	probably benign	Het
Picalm	T	A	7: 90,189,219	F493Y	probably damaging	Het
Prl7d1	A	G	13: 27,716,668	M1T	probably null	Het
Prl8a1	T	C	13: 27,575,458	K199E	possibly damaging	Het
Rims1	C	T	1: 22,428,489	R764H	probably damaging	Het
Rnf17	G	T	14: 56,475,413	R779L	possibly damaging	Het
Rufy2	T	C	10: 62,998,137	L294P	probably damaging	Het
Sgsh	A	G	11: 119,350,947	L111P	probably damaging	Het
Slc22a30	G	T	19: 8,336,849	T491K	probably benign	Het
Slc35b3	T	C	13: 38,943,068	N20D	possibly damaging	Het
Slc5a4a	T	C	10: 76,181,655	F429L	probably benign	Het
Sulf1	T	C	1: 12,817,412	I270T	probably damaging	Het
Tmem51	T	C	4: 142,031,748	T230A	probably damaging	Het
Tnc	T	A	4: 64,008,710	I860F	probably damaging	Het
Trh	A	T	6: 92,243,698	V61E	possibly damaging	Het
Ttn	T	G	2: 76,754,099	T22222P	probably damaging	Het
Uroc1	A	T	6: 90,361,512	K652*	probably null	Het
Usp34	C	T	11: 23,489,033	P3532S	possibly damaging	Het
Vmn2r120	A	T	17: 57,524,954	F278L	probably benign	Het
Vmn2r7	A	G	3: 64,719,611	F86L	possibly damaging	Het
Vmn2r87	A	T	10: 130,479,987	I70K	possibly damaging	Het
Vps13a	C	T	19: 16,744,953	A332T	probably benign	Het
Zfp568	T	A	7: 30,023,396	C589S	probably damaging	Het

Other mutations in Itpa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01484:Itpa	APN	2	130672099	missense	probably benign	0.14
IGL03202:Itpa	APN	2	130667939	unclassified	probably benign
R0110:Itpa	UTSW	2	130679418	splice site	probably benign
R3872:Itpa	UTSW	2	130681010	missense	probably damaging	1.00
R3873:Itpa	UTSW	2	130681010	missense	probably damaging	1.00
R7768:Itpa	UTSW	2	130667916	missense	probably damaging	1.00
R8708:Itpa	UTSW	2	130675719	missense	probably damaging	0.97
R9089:Itpa	UTSW	2	130667937	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ATTTGGGCTTCTTCCTATGCAG -3'
(R):5'- AGAACTGGCTCCTGATGCTG -3'

Sequencing Primer
(F):5'- TTATGGGGCTCACATAACTGAAGCC -3'
(R):5'- GATGCTGCCTGGATCTCCTG -3'

Posted On

2015-04-06