Incidental Mutation 'R3874:Hspa4l'
ID276707
Institutional Source Beutler Lab
Gene Symbol Hspa4l
Ensembl Gene ENSMUSG00000025757
Gene Nameheat shock protein 4 like
Synonyms94kDa, Osp94, APG-1
MMRRC Submission 040792-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R3874 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location40744495-40796103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40772642 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 492 (V492M)
Ref Sequence ENSEMBL: ENSMUSP00000145468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108086] [ENSMUST00000203353] [ENSMUST00000204702]
Predicted Effect probably damaging
Transcript: ENSMUST00000077083
AA Change: V492M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076336
Gene: ENSMUSG00000025757
AA Change: V492M

DomainStartEndE-ValueType
Pfam:HSP70 3 694 1.3e-192 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108086
AA Change: V471M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103721
Gene: ENSMUSG00000025757
AA Change: V471M

DomainStartEndE-ValueType
Pfam:HSP70 11 673 2.1e-171 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203353
AA Change: V492M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144787
Gene: ENSMUSG00000025757
AA Change: V492M

DomainStartEndE-ValueType
Pfam:HSP70 3 570 6.2e-184 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203425
Predicted Effect probably damaging
Transcript: ENSMUST00000204702
AA Change: V492M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145468
Gene: ENSMUSG00000025757
AA Change: V492M

DomainStartEndE-ValueType
Pfam:HSP70 3 694 1.3e-192 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is heat shock inducible and may act as a chaperone. The encoded protein can protect the heat-shocked cell against the harmful effects of aggregated proteins. This gene is highly expressed in leukemia cells and may be a good target for therapeutic intervention. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display increased incidence of male infertility, due to reduced number of mature sperm and reduced sperm motility, and hydronephrosis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130213A22Rik C A 11: 69,121,475 G26* probably null Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Acox2 A G 14: 8,248,061 I407T probably benign Het
Adam8 T C 7: 139,987,607 N408D probably damaging Het
Adgre1 A T 17: 57,401,925 T39S probably benign Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Arid1b T A 17: 5,336,515 probably null Het
Atp2c2 A G 8: 119,735,296 I303V possibly damaging Het
Bpifc C T 10: 85,991,254 V144I probably benign Het
C530008M17Rik A G 5: 76,840,892 D30G probably damaging Het
Camk4 A G 18: 33,158,854 E189G possibly damaging Het
Casz1 A G 4: 148,939,589 probably benign Het
Ccdc134 T C 15: 82,131,442 V41A possibly damaging Het
Chrd A T 16: 20,738,910 T753S probably damaging Het
Cyb561a3 T C 19: 10,585,371 V125A probably benign Het
D630039A03Rik T A 4: 57,910,606 T69S probably benign Het
Dchs1 A G 7: 105,761,635 F1687S probably damaging Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dnaic2 G T 11: 114,732,955 G15W probably damaging Het
Dsg1c A G 18: 20,277,052 I526V probably benign Het
Far2 G A 6: 148,150,591 E123K probably benign Het
Gli1 A T 10: 127,330,219 V1055E probably damaging Het
Hand2 G T 8: 57,321,976 A24S probably benign Het
Helb T C 10: 120,106,037 I249V probably benign Het
Hspg2 T C 4: 137,539,349 I1916T probably damaging Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Kcnu1 T A 8: 25,885,317 L353H probably damaging Het
Klhl1 A G 14: 96,518,179 F47L probably benign Het
Klhl13 T C X: 23,285,176 D21G probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Krt9 C T 11: 100,190,849 V285I probably damaging Het
Mansc1 T C 6: 134,610,183 R344G possibly damaging Het
Mier2 G T 10: 79,541,797 P439T possibly damaging Het
Mppe1 T A 18: 67,225,886 probably null Het
Nedd4l G A 18: 65,167,535 A243T probably benign Het
Notch4 T A 17: 34,578,069 C934* probably null Het
Nsmce3 C T 7: 64,872,168 D251N probably damaging Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Olfr139 A G 11: 74,044,699 C192R probably damaging Het
Olfr517 C T 7: 108,869,128 V9M probably damaging Het
Olfr937 A G 9: 39,060,174 I164T probably benign Het
Pdzd7 T C 19: 45,045,628 T6A probably benign Het
Picalm T A 7: 90,189,219 F493Y probably damaging Het
Prl7d1 A G 13: 27,716,668 M1T probably null Het
Prl8a1 T C 13: 27,575,458 K199E possibly damaging Het
Rims1 C T 1: 22,428,489 R764H probably damaging Het
Rnf17 G T 14: 56,475,413 R779L possibly damaging Het
Rufy2 T C 10: 62,998,137 L294P probably damaging Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Slc22a30 G T 19: 8,336,849 T491K probably benign Het
Slc35b3 T C 13: 38,943,068 N20D possibly damaging Het
Slc5a4a T C 10: 76,181,655 F429L probably benign Het
Sulf1 T C 1: 12,817,412 I270T probably damaging Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Tnc T A 4: 64,008,710 I860F probably damaging Het
Trh A T 6: 92,243,698 V61E possibly damaging Het
Ttn T G 2: 76,754,099 T22222P probably damaging Het
Uroc1 A T 6: 90,361,512 K652* probably null Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r120 A T 17: 57,524,954 F278L probably benign Het
Vmn2r7 A G 3: 64,719,611 F86L possibly damaging Het
Vmn2r87 A T 10: 130,479,987 I70K possibly damaging Het
Vps13a C T 19: 16,744,953 A332T probably benign Het
Zfp568 T A 7: 30,023,396 C589S probably damaging Het
Other mutations in Hspa4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02466:Hspa4l APN 3 40753225 nonsense probably null
IGL02605:Hspa4l APN 3 40781623 missense probably benign 0.20
IGL02719:Hspa4l APN 3 40772658 missense possibly damaging 0.60
R0281:Hspa4l UTSW 3 40785408 splice site probably benign
R0398:Hspa4l UTSW 3 40756997 splice site probably benign
R0487:Hspa4l UTSW 3 40784326 missense possibly damaging 0.87
R0610:Hspa4l UTSW 3 40779400 missense probably benign 0.01
R0760:Hspa4l UTSW 3 40784723 nonsense probably null
R1491:Hspa4l UTSW 3 40786794 missense probably benign 0.00
R1720:Hspa4l UTSW 3 40781617 nonsense probably null
R1984:Hspa4l UTSW 3 40760401 missense probably damaging 1.00
R1986:Hspa4l UTSW 3 40760401 missense probably damaging 1.00
R2100:Hspa4l UTSW 3 40772658 missense possibly damaging 0.60
R3706:Hspa4l UTSW 3 40781693 missense possibly damaging 0.55
R3708:Hspa4l UTSW 3 40781693 missense possibly damaging 0.55
R3856:Hspa4l UTSW 3 40785389 missense probably benign 0.29
R3890:Hspa4l UTSW 3 40781594 missense possibly damaging 0.90
R4256:Hspa4l UTSW 3 40746003 missense probably benign 0.03
R4364:Hspa4l UTSW 3 40766809 splice site probably null
R4365:Hspa4l UTSW 3 40766809 splice site probably null
R4366:Hspa4l UTSW 3 40766809 splice site probably null
R4493:Hspa4l UTSW 3 40768002 missense possibly damaging 0.77
R4494:Hspa4l UTSW 3 40753204 missense possibly damaging 0.86
R4954:Hspa4l UTSW 3 40785400 critical splice donor site probably null
R4994:Hspa4l UTSW 3 40745649 utr 5 prime probably benign
R5114:Hspa4l UTSW 3 40745765 missense possibly damaging 0.60
R5133:Hspa4l UTSW 3 40786747 missense possibly damaging 0.94
R5202:Hspa4l UTSW 3 40781569 missense probably benign 0.17
R5440:Hspa4l UTSW 3 40781576 missense probably damaging 1.00
R5635:Hspa4l UTSW 3 40745745 missense probably damaging 1.00
R5997:Hspa4l UTSW 3 40767979 missense probably damaging 0.99
R6012:Hspa4l UTSW 3 40781599 missense probably benign 0.09
R6515:Hspa4l UTSW 3 40781582 missense possibly damaging 0.82
R6589:Hspa4l UTSW 3 40757055 missense probably damaging 0.99
R7091:Hspa4l UTSW 3 40781592 missense probably benign 0.00
R7601:Hspa4l UTSW 3 40784356 critical splice donor site probably null
R8072:Hspa4l UTSW 3 40786746 missense probably damaging 0.98
Z1088:Hspa4l UTSW 3 40766993 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCATGGCAGTCATCTAGAAC -3'
(R):5'- AAGGTACTCACTACGGAGGTG -3'

Sequencing Primer
(F):5'- CATGGCAGTCATCTAGAACTGAATC -3'
(R):5'- CACTACGGAGGTGCTGTCAATATC -3'
Posted On2015-04-06