Incidental Mutation 'R3874:Vmn2r7'
ID 276708
Institutional Source Beutler Lab
Gene Symbol Vmn2r7
Ensembl Gene ENSMUSG00000116028
Gene Name
Synonyms
MMRRC Submission 040792-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock # R3874 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 64690660-64719602 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 64719611 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 86 (F86L)
Ref Sequence ENSEMBL: ENSMUSP00000124192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161972] [ENSMUST00000168072]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050123
Predicted Effect possibly damaging
Transcript: ENSMUST00000161972
AA Change: F86L

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124192
Gene: ENSMUSG00000062200
AA Change: F86L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 90 507 3.8e-77 PFAM
Pfam:NCD3G 549 602 3.4e-17 PFAM
Pfam:7tm_3 635 869 1.1e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168072
SMART Domains Protein: ENSMUSP00000131220
Gene: ENSMUSG00000116028

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 5.1e-72 PFAM
Pfam:Peripla_BP_6 63 245 6.1e-10 PFAM
Pfam:NCD3G 458 511 1.8e-17 PFAM
Pfam:7tm_3 542 779 4.3e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177146
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130213A22Rik C A 11: 69,121,475 G26* probably null Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Acox2 A G 14: 8,248,061 I407T probably benign Het
Adam8 T C 7: 139,987,607 N408D probably damaging Het
Adgre1 A T 17: 57,401,925 T39S probably benign Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Arid1b T A 17: 5,336,515 probably null Het
Atp2c2 A G 8: 119,735,296 I303V possibly damaging Het
Bpifc C T 10: 85,991,254 V144I probably benign Het
C530008M17Rik A G 5: 76,840,892 D30G probably damaging Het
Camk4 A G 18: 33,158,854 E189G possibly damaging Het
Casz1 A G 4: 148,939,589 probably benign Het
Ccdc134 T C 15: 82,131,442 V41A possibly damaging Het
Chrd A T 16: 20,738,910 T753S probably damaging Het
Cyb561a3 T C 19: 10,585,371 V125A probably benign Het
D630039A03Rik T A 4: 57,910,606 T69S probably benign Het
Dchs1 A G 7: 105,761,635 F1687S probably damaging Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dnaic2 G T 11: 114,732,955 G15W probably damaging Het
Dsg1c A G 18: 20,277,052 I526V probably benign Het
Far2 G A 6: 148,150,591 E123K probably benign Het
Gli1 A T 10: 127,330,219 V1055E probably damaging Het
Hand2 G T 8: 57,321,976 A24S probably benign Het
Helb T C 10: 120,106,037 I249V probably benign Het
Hspa4l G A 3: 40,772,642 V492M probably damaging Het
Hspg2 T C 4: 137,539,349 I1916T probably damaging Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Kcnu1 T A 8: 25,885,317 L353H probably damaging Het
Klhl1 A G 14: 96,518,179 F47L probably benign Het
Klhl13 T C X: 23,285,176 D21G probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Krt9 C T 11: 100,190,849 V285I probably damaging Het
Mansc1 T C 6: 134,610,183 R344G possibly damaging Het
Mier2 G T 10: 79,541,797 P439T possibly damaging Het
Mppe1 T A 18: 67,225,886 probably null Het
Nedd4l G A 18: 65,167,535 A243T probably benign Het
Notch4 T A 17: 34,578,069 C934* probably null Het
Nsmce3 C T 7: 64,872,168 D251N probably damaging Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Olfr139 A G 11: 74,044,699 C192R probably damaging Het
Olfr517 C T 7: 108,869,128 V9M probably damaging Het
Olfr937 A G 9: 39,060,174 I164T probably benign Het
Pdzd7 T C 19: 45,045,628 T6A probably benign Het
Picalm T A 7: 90,189,219 F493Y probably damaging Het
Prl7d1 A G 13: 27,716,668 M1T probably null Het
Prl8a1 T C 13: 27,575,458 K199E possibly damaging Het
Rims1 C T 1: 22,428,489 R764H probably damaging Het
Rnf17 G T 14: 56,475,413 R779L possibly damaging Het
Rufy2 T C 10: 62,998,137 L294P probably damaging Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Slc22a30 G T 19: 8,336,849 T491K probably benign Het
Slc35b3 T C 13: 38,943,068 N20D possibly damaging Het
Slc5a4a T C 10: 76,181,655 F429L probably benign Het
Sulf1 T C 1: 12,817,412 I270T probably damaging Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Tnc T A 4: 64,008,710 I860F probably damaging Het
Trh A T 6: 92,243,698 V61E possibly damaging Het
Ttn T G 2: 76,754,099 T22222P probably damaging Het
Uroc1 A T 6: 90,361,512 K652* probably null Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r120 A T 17: 57,524,954 F278L probably benign Het
Vmn2r87 A T 10: 130,479,987 I70K possibly damaging Het
Vps13a C T 19: 16,744,953 A332T probably benign Het
Zfp568 T A 7: 30,023,396 C589S probably damaging Het
Other mutations in Vmn2r7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Vmn2r7 APN 3 64715813 missense possibly damaging 0.60
IGL01762:Vmn2r7 APN 3 64691435 missense probably benign 0.39
IGL01903:Vmn2r7 APN 3 64719443 missense probably benign 0.00
IGL02263:Vmn2r7 APN 3 64691447 missense probably damaging 1.00
IGL02458:Vmn2r7 APN 3 64693025 missense probably damaging 0.97
IGL02593:Vmn2r7 APN 3 64693022 missense probably damaging 1.00
IGL02797:Vmn2r7 APN 3 64691245 missense possibly damaging 0.80
IGL03047:Vmn2r7 UTSW 3 64707218 missense possibly damaging 0.81
PIT4504001:Vmn2r7 UTSW 3 64715976 missense probably benign 0.01
R0193:Vmn2r7 UTSW 3 64691039 missense probably damaging 1.00
R0329:Vmn2r7 UTSW 3 64691018 missense probably damaging 1.00
R0609:Vmn2r7 UTSW 3 64716479 missense probably benign 0.44
R0735:Vmn2r7 UTSW 3 64716367 missense probably benign 0.02
R0941:Vmn2r7 UTSW 3 64716579 missense probably benign
R1065:Vmn2r7 UTSW 3 64707138 missense possibly damaging 0.82
R1378:Vmn2r7 UTSW 3 64691604 missense possibly damaging 0.59
R1445:Vmn2r7 UTSW 3 64724802 missense probably benign 0.01
R1506:Vmn2r7 UTSW 3 64707079 missense probably benign
R1509:Vmn2r7 UTSW 3 64716460 nonsense probably null
R1519:Vmn2r7 UTSW 3 64716455 missense possibly damaging 0.95
R1706:Vmn2r7 UTSW 3 64691459 missense possibly damaging 0.79
R2113:Vmn2r7 UTSW 3 64691604 missense possibly damaging 0.59
R3725:Vmn2r7 UTSW 3 64724991 missense possibly damaging 0.65
R3902:Vmn2r7 UTSW 3 64719516 missense possibly damaging 0.46
R4084:Vmn2r7 UTSW 3 64692993 missense probably benign 0.08
R4117:Vmn2r7 UTSW 3 64715717 intron probably benign
R4333:Vmn2r7 UTSW 3 64690778 missense probably damaging 1.00
R4551:Vmn2r7 UTSW 3 64690689 missense possibly damaging 0.86
R4643:Vmn2r7 UTSW 3 64716404 missense probably damaging 1.00
R4654:Vmn2r7 UTSW 3 64719443 missense probably benign 0.00
R5091:Vmn2r7 UTSW 3 64690784 missense possibly damaging 0.63
R5109:Vmn2r7 UTSW 3 64690667 missense probably null 0.84
R5372:Vmn2r7 UTSW 3 64716324 missense probably damaging 1.00
R5415:Vmn2r7 UTSW 3 64716237 missense probably benign 0.07
R5740:Vmn2r7 UTSW 3 64707233 missense probably benign
R5977:Vmn2r7 UTSW 3 64716043 nonsense probably null
R6019:Vmn2r7 UTSW 3 64716222 missense probably damaging 1.00
R6058:Vmn2r7 UTSW 3 64725015 missense probably benign 0.00
R6139:Vmn2r7 UTSW 3 64715918 missense probably damaging 1.00
R6696:Vmn2r7 UTSW 3 64707074 missense probably benign 0.01
R6887:Vmn2r7 UTSW 3 64690827 missense probably damaging 1.00
R6918:Vmn2r7 UTSW 3 64691339 missense probably benign 0.03
R6949:Vmn2r7 UTSW 3 64691121 missense probably damaging 0.99
R6980:Vmn2r7 UTSW 3 64716566 missense possibly damaging 0.67
R7196:Vmn2r7 UTSW 3 64715777 missense probably benign 0.00
R7286:Vmn2r7 UTSW 3 64690880 missense probably benign 0.00
R7455:Vmn2r7 UTSW 3 64716593 missense probably benign
R7557:Vmn2r7 UTSW 3 64724973 missense probably benign
R7864:Vmn2r7 UTSW 3 64691526 missense probably benign 0.10
R8046:Vmn2r7 UTSW 3 64707058 missense probably damaging 1.00
R8068:Vmn2r7 UTSW 3 64716086 missense probably benign 0.01
R8252:Vmn2r7 UTSW 3 64693106 missense probably benign 0.00
R8814:Vmn2r7 UTSW 3 64716563 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CCAGTGCTGTTTCTCCAGTTAG -3'
(R):5'- AGCAATGTTCAGGTGTAGTTTCTTC -3'

Sequencing Primer
(F):5'- AGTTAGGTTTGTATTCCTCCTGC -3'
(R):5'- TTAATTGTGTTTCCTCACTGGC -3'
Posted On 2015-04-06