Incidental Mutation 'R3874:Uroc1'
ID276716
Institutional Source Beutler Lab
Gene Symbol Uroc1
Ensembl Gene ENSMUSG00000034456
Gene Nameurocanase domain containing 1
Synonyms
MMRRC Submission 040792-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3874 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location90333284-90364551 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 90361512 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 652 (K652*)
Ref Sequence ENSEMBL: ENSMUSP00000127114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046128] [ENSMUST00000164761]
Predicted Effect probably null
Transcript: ENSMUST00000046128
AA Change: K618*
SMART Domains Protein: ENSMUSP00000040424
Gene: ENSMUSG00000034456
AA Change: K618*

DomainStartEndE-ValueType
Pfam:Urocanase 84 662 2.7e-231 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000164761
AA Change: K652*
SMART Domains Protein: ENSMUSP00000127114
Gene: ENSMUSG00000034456
AA Change: K652*

DomainStartEndE-ValueType
Pfam:Urocanase 85 316 1.4e-102 PFAM
Pfam:Urocanase 319 683 8.7e-144 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in histidine catabolism, metabolizing urocanic acid to formiminoglutamic acid. The gene product is known to protect the skin from ultra violet rays and is contained in human sweat. Deficiency of this gene product in the liver is an apparent cause of mental retardation. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130213A22Rik C A 11: 69,121,475 G26* probably null Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Acox2 A G 14: 8,248,061 I407T probably benign Het
Adam8 T C 7: 139,987,607 N408D probably damaging Het
Adgre1 A T 17: 57,401,925 T39S probably benign Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Arid1b T A 17: 5,336,515 probably null Het
Atp2c2 A G 8: 119,735,296 I303V possibly damaging Het
Bpifc C T 10: 85,991,254 V144I probably benign Het
C530008M17Rik A G 5: 76,840,892 D30G probably damaging Het
Camk4 A G 18: 33,158,854 E189G possibly damaging Het
Casz1 A G 4: 148,939,589 probably benign Het
Ccdc134 T C 15: 82,131,442 V41A possibly damaging Het
Chrd A T 16: 20,738,910 T753S probably damaging Het
Cyb561a3 T C 19: 10,585,371 V125A probably benign Het
D630039A03Rik T A 4: 57,910,606 T69S probably benign Het
Dchs1 A G 7: 105,761,635 F1687S probably damaging Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dnaic2 G T 11: 114,732,955 G15W probably damaging Het
Dsg1c A G 18: 20,277,052 I526V probably benign Het
Far2 G A 6: 148,150,591 E123K probably benign Het
Gli1 A T 10: 127,330,219 V1055E probably damaging Het
Hand2 G T 8: 57,321,976 A24S probably benign Het
Helb T C 10: 120,106,037 I249V probably benign Het
Hspa4l G A 3: 40,772,642 V492M probably damaging Het
Hspg2 T C 4: 137,539,349 I1916T probably damaging Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Kcnu1 T A 8: 25,885,317 L353H probably damaging Het
Klhl1 A G 14: 96,518,179 F47L probably benign Het
Klhl13 T C X: 23,285,176 D21G probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Krt9 C T 11: 100,190,849 V285I probably damaging Het
Mansc1 T C 6: 134,610,183 R344G possibly damaging Het
Mier2 G T 10: 79,541,797 P439T possibly damaging Het
Mppe1 T A 18: 67,225,886 probably null Het
Nedd4l G A 18: 65,167,535 A243T probably benign Het
Notch4 T A 17: 34,578,069 C934* probably null Het
Nsmce3 C T 7: 64,872,168 D251N probably damaging Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Olfr139 A G 11: 74,044,699 C192R probably damaging Het
Olfr517 C T 7: 108,869,128 V9M probably damaging Het
Olfr937 A G 9: 39,060,174 I164T probably benign Het
Pdzd7 T C 19: 45,045,628 T6A probably benign Het
Picalm T A 7: 90,189,219 F493Y probably damaging Het
Prl7d1 A G 13: 27,716,668 M1T probably null Het
Prl8a1 T C 13: 27,575,458 K199E possibly damaging Het
Rims1 C T 1: 22,428,489 R764H probably damaging Het
Rnf17 G T 14: 56,475,413 R779L possibly damaging Het
Rufy2 T C 10: 62,998,137 L294P probably damaging Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Slc22a30 G T 19: 8,336,849 T491K probably benign Het
Slc35b3 T C 13: 38,943,068 N20D possibly damaging Het
Slc5a4a T C 10: 76,181,655 F429L probably benign Het
Sulf1 T C 1: 12,817,412 I270T probably damaging Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Tnc T A 4: 64,008,710 I860F probably damaging Het
Trh A T 6: 92,243,698 V61E possibly damaging Het
Ttn T G 2: 76,754,099 T22222P probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r120 A T 17: 57,524,954 F278L probably benign Het
Vmn2r7 A G 3: 64,719,611 F86L possibly damaging Het
Vmn2r87 A T 10: 130,479,987 I70K possibly damaging Het
Vps13a C T 19: 16,744,953 A332T probably benign Het
Zfp568 T A 7: 30,023,396 C589S probably damaging Het
Other mutations in Uroc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Uroc1 APN 6 90338828 missense probably benign
IGL01015:Uroc1 APN 6 90358901 splice site probably benign
IGL01386:Uroc1 APN 6 90346765 missense probably damaging 0.99
IGL01449:Uroc1 APN 6 90338653 missense probably damaging 1.00
IGL01514:Uroc1 APN 6 90363100 splice site probably benign
IGL02060:Uroc1 APN 6 90338255 missense probably benign 0.03
IGL02247:Uroc1 APN 6 90347928 missense probably benign 0.00
IGL02256:Uroc1 APN 6 90346687 missense possibly damaging 0.83
IGL02886:Uroc1 APN 6 90346829 splice site probably benign
IGL03087:Uroc1 APN 6 90363103 splice site probably benign
PIT4651001:Uroc1 UTSW 6 90363113 nonsense probably null
R0034:Uroc1 UTSW 6 90345310 missense probably damaging 1.00
R0245:Uroc1 UTSW 6 90344197 missense probably damaging 1.00
R0402:Uroc1 UTSW 6 90347302 missense probably damaging 1.00
R0570:Uroc1 UTSW 6 90338564 missense possibly damaging 0.90
R0729:Uroc1 UTSW 6 90336955 missense probably damaging 1.00
R1471:Uroc1 UTSW 6 90344171 missense probably damaging 1.00
R1782:Uroc1 UTSW 6 90336919 missense probably damaging 1.00
R1866:Uroc1 UTSW 6 90361524 missense probably benign 0.03
R1983:Uroc1 UTSW 6 90345369 missense probably damaging 1.00
R2086:Uroc1 UTSW 6 90344114 missense probably damaging 1.00
R2321:Uroc1 UTSW 6 90347247 missense possibly damaging 0.94
R3720:Uroc1 UTSW 6 90346355 missense probably damaging 1.00
R4628:Uroc1 UTSW 6 90355328 missense probably damaging 0.99
R4810:Uroc1 UTSW 6 90363153 missense probably damaging 1.00
R4820:Uroc1 UTSW 6 90357618 critical splice donor site probably null
R4838:Uroc1 UTSW 6 90349192 missense possibly damaging 0.90
R4880:Uroc1 UTSW 6 90357537 missense probably damaging 1.00
R4964:Uroc1 UTSW 6 90345394 missense probably damaging 0.98
R4966:Uroc1 UTSW 6 90345394 missense probably damaging 0.98
R5468:Uroc1 UTSW 6 90338604 missense probably benign 0.45
R5592:Uroc1 UTSW 6 90355344 missense probably damaging 0.99
R5698:Uroc1 UTSW 6 90347320 missense probably damaging 1.00
R5789:Uroc1 UTSW 6 90344197 missense probably damaging 1.00
R5853:Uroc1 UTSW 6 90346756 missense probably damaging 0.99
R6063:Uroc1 UTSW 6 90347928 missense probably benign 0.37
R6883:Uroc1 UTSW 6 90338592 nonsense probably null
R7374:Uroc1 UTSW 6 90338833 missense probably damaging 1.00
R7394:Uroc1 UTSW 6 90345333 missense probably damaging 1.00
R7427:Uroc1 UTSW 6 90346362 missense possibly damaging 0.56
R8376:Uroc1 UTSW 6 90337715 missense probably damaging 0.99
X0021:Uroc1 UTSW 6 90344150 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TGTTCTGCTGGTCACATGGC -3'
(R):5'- ATACTGCAGGGTGAGACCAG -3'

Sequencing Primer
(F):5'- CACATGGCTTTATGAGGTAGAGGTC -3'
(R):5'- GGTGGTTCACAACAGTATCTCCAG -3'
Posted On2015-04-06