Incidental Mutation 'R3874:Uroc1'
ID 276716
Institutional Source Beutler Lab
Gene Symbol Uroc1
Ensembl Gene ENSMUSG00000034456
Gene Name urocanase domain containing 1
Synonyms
MMRRC Submission 040792-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3874 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 90310266-90341533 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 90338494 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 652 (K652*)
Ref Sequence ENSEMBL: ENSMUSP00000127114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046128] [ENSMUST00000164761]
AlphaFold Q8VC12
Predicted Effect probably null
Transcript: ENSMUST00000046128
AA Change: K618*
SMART Domains Protein: ENSMUSP00000040424
Gene: ENSMUSG00000034456
AA Change: K618*

DomainStartEndE-ValueType
Pfam:Urocanase 84 662 2.7e-231 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000164761
AA Change: K652*
SMART Domains Protein: ENSMUSP00000127114
Gene: ENSMUSG00000034456
AA Change: K652*

DomainStartEndE-ValueType
Pfam:Urocanase 85 316 1.4e-102 PFAM
Pfam:Urocanase 319 683 8.7e-144 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in histidine catabolism, metabolizing urocanic acid to formiminoglutamic acid. The gene product is known to protect the skin from ultra violet rays and is contained in human sweat. Deficiency of this gene product in the liver is an apparent cause of mental retardation. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130213A22Rik C A 11: 69,012,301 (GRCm39) G26* probably null Het
Abca5 T A 11: 110,201,059 (GRCm39) Y447F probably damaging Het
Acox2 A G 14: 8,248,061 (GRCm38) I407T probably benign Het
Adam8 T C 7: 139,567,520 (GRCm39) N408D probably damaging Het
Adgre1 A T 17: 57,708,925 (GRCm39) T39S probably benign Het
Akap12 G A 10: 4,307,590 (GRCm39) V1467I probably benign Het
Arid1b T A 17: 5,386,790 (GRCm39) probably null Het
Atp2c2 A G 8: 120,462,035 (GRCm39) I303V possibly damaging Het
Bpifc C T 10: 85,827,118 (GRCm39) V144I probably benign Het
Camk4 A G 18: 33,291,907 (GRCm39) E189G possibly damaging Het
Casz1 A G 4: 149,024,046 (GRCm39) probably benign Het
Ccdc134 T C 15: 82,015,643 (GRCm39) V41A possibly damaging Het
Chrd A T 16: 20,557,660 (GRCm39) T753S probably damaging Het
Cracd A G 5: 76,988,739 (GRCm39) D30G probably damaging Het
Cyb561a3 T C 19: 10,562,735 (GRCm39) V125A probably benign Het
D630039A03Rik T A 4: 57,910,606 (GRCm39) T69S probably benign Het
Dchs1 A G 7: 105,410,842 (GRCm39) F1687S probably damaging Het
Dlgap4 T C 2: 156,591,267 (GRCm39) S818P probably benign Het
Dnah2 A G 11: 69,320,174 (GRCm39) I3965T probably damaging Het
Dnai2 G T 11: 114,623,781 (GRCm39) G15W probably damaging Het
Dsg1c A G 18: 20,410,109 (GRCm39) I526V probably benign Het
Far2 G A 6: 148,052,089 (GRCm39) E123K probably benign Het
Gli1 A T 10: 127,166,088 (GRCm39) V1055E probably damaging Het
Hand2 G T 8: 57,775,011 (GRCm39) A24S probably benign Het
Helb T C 10: 119,941,942 (GRCm39) I249V probably benign Het
Hspa4l G A 3: 40,727,074 (GRCm39) V492M probably damaging Het
Hspg2 T C 4: 137,266,660 (GRCm39) I1916T probably damaging Het
Igfals G A 17: 25,100,579 (GRCm39) V557I possibly damaging Het
Itpa T G 2: 130,522,930 (GRCm39) S176A probably damaging Het
Kcnu1 T A 8: 26,375,345 (GRCm39) L353H probably damaging Het
Klhl1 A G 14: 96,755,615 (GRCm39) F47L probably benign Het
Klhl13 T C X: 23,151,415 (GRCm39) D21G probably benign Het
Krt26 T C 11: 99,225,570 (GRCm39) K304E probably damaging Het
Krt9 C T 11: 100,081,675 (GRCm39) V285I probably damaging Het
Mansc1 T C 6: 134,587,146 (GRCm39) R344G possibly damaging Het
Mier2 G T 10: 79,377,631 (GRCm39) P439T possibly damaging Het
Mppe1 T A 18: 67,358,957 (GRCm39) probably null Het
Nedd4l G A 18: 65,300,606 (GRCm39) A243T probably benign Het
Notch4 T A 17: 34,797,043 (GRCm39) C934* probably null Het
Nsmce3 C T 7: 64,521,916 (GRCm39) D251N probably damaging Het
Or10a49 C T 7: 108,468,335 (GRCm39) V9M probably damaging Het
Or12d12 T A 17: 37,610,870 (GRCm39) T148S probably benign Het
Or3a10 A G 11: 73,935,525 (GRCm39) C192R probably damaging Het
Or4f6 T C 2: 111,838,668 (GRCm39) T288A possibly damaging Het
Or5l13 T A 2: 87,779,874 (GRCm39) R234S probably damaging Het
Or8g23 A G 9: 38,971,470 (GRCm39) I164T probably benign Het
Pdzd7 T C 19: 45,034,067 (GRCm39) T6A probably benign Het
Picalm T A 7: 89,838,427 (GRCm39) F493Y probably damaging Het
Prl7d1 A G 13: 27,900,651 (GRCm39) M1T probably null Het
Prl8a1 T C 13: 27,759,441 (GRCm39) K199E possibly damaging Het
Rims1 C T 1: 22,498,740 (GRCm39) R764H probably damaging Het
Rnf17 G T 14: 56,712,870 (GRCm39) R779L possibly damaging Het
Rufy2 T C 10: 62,833,916 (GRCm39) L294P probably damaging Het
Sgsh A G 11: 119,241,773 (GRCm39) L111P probably damaging Het
Slc22a30 G T 19: 8,314,213 (GRCm39) T491K probably benign Het
Slc35b3 T C 13: 39,127,044 (GRCm39) N20D possibly damaging Het
Slc5a4a T C 10: 76,017,489 (GRCm39) F429L probably benign Het
Sulf1 T C 1: 12,887,636 (GRCm39) I270T probably damaging Het
Tmem51 T C 4: 141,759,059 (GRCm39) T230A probably damaging Het
Tnc T A 4: 63,926,947 (GRCm39) I860F probably damaging Het
Trh A T 6: 92,220,679 (GRCm39) V61E possibly damaging Het
Ttn T G 2: 76,584,443 (GRCm39) T22222P probably damaging Het
Usp34 C T 11: 23,439,033 (GRCm39) P3532S possibly damaging Het
Vmn2r120 A T 17: 57,831,954 (GRCm39) F278L probably benign Het
Vmn2r7 A G 3: 64,627,032 (GRCm39) F86L possibly damaging Het
Vmn2r87 A T 10: 130,315,856 (GRCm39) I70K possibly damaging Het
Vps13a C T 19: 16,722,317 (GRCm39) A332T probably benign Het
Zfp568 T A 7: 29,722,821 (GRCm39) C589S probably damaging Het
Other mutations in Uroc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Uroc1 APN 6 90,315,810 (GRCm39) missense probably benign
IGL01015:Uroc1 APN 6 90,335,883 (GRCm39) splice site probably benign
IGL01386:Uroc1 APN 6 90,323,747 (GRCm39) missense probably damaging 0.99
IGL01449:Uroc1 APN 6 90,315,635 (GRCm39) missense probably damaging 1.00
IGL01514:Uroc1 APN 6 90,340,082 (GRCm39) splice site probably benign
IGL02060:Uroc1 APN 6 90,315,237 (GRCm39) missense probably benign 0.03
IGL02247:Uroc1 APN 6 90,324,910 (GRCm39) missense probably benign 0.00
IGL02256:Uroc1 APN 6 90,323,669 (GRCm39) missense possibly damaging 0.83
IGL02886:Uroc1 APN 6 90,323,811 (GRCm39) splice site probably benign
IGL03087:Uroc1 APN 6 90,340,085 (GRCm39) splice site probably benign
PIT4651001:Uroc1 UTSW 6 90,340,095 (GRCm39) nonsense probably null
R0034:Uroc1 UTSW 6 90,322,292 (GRCm39) missense probably damaging 1.00
R0245:Uroc1 UTSW 6 90,321,179 (GRCm39) missense probably damaging 1.00
R0402:Uroc1 UTSW 6 90,324,284 (GRCm39) missense probably damaging 1.00
R0570:Uroc1 UTSW 6 90,315,546 (GRCm39) missense possibly damaging 0.90
R0729:Uroc1 UTSW 6 90,313,937 (GRCm39) missense probably damaging 1.00
R1471:Uroc1 UTSW 6 90,321,153 (GRCm39) missense probably damaging 1.00
R1782:Uroc1 UTSW 6 90,313,901 (GRCm39) missense probably damaging 1.00
R1866:Uroc1 UTSW 6 90,338,506 (GRCm39) missense probably benign 0.03
R1983:Uroc1 UTSW 6 90,322,351 (GRCm39) missense probably damaging 1.00
R2086:Uroc1 UTSW 6 90,321,096 (GRCm39) missense probably damaging 1.00
R2321:Uroc1 UTSW 6 90,324,229 (GRCm39) missense possibly damaging 0.94
R3720:Uroc1 UTSW 6 90,323,337 (GRCm39) missense probably damaging 1.00
R4628:Uroc1 UTSW 6 90,332,310 (GRCm39) missense probably damaging 0.99
R4810:Uroc1 UTSW 6 90,340,135 (GRCm39) missense probably damaging 1.00
R4820:Uroc1 UTSW 6 90,334,600 (GRCm39) critical splice donor site probably null
R4838:Uroc1 UTSW 6 90,326,174 (GRCm39) missense possibly damaging 0.90
R4880:Uroc1 UTSW 6 90,334,519 (GRCm39) missense probably damaging 1.00
R4964:Uroc1 UTSW 6 90,322,376 (GRCm39) missense probably damaging 0.98
R4966:Uroc1 UTSW 6 90,322,376 (GRCm39) missense probably damaging 0.98
R5468:Uroc1 UTSW 6 90,315,586 (GRCm39) missense probably benign 0.45
R5592:Uroc1 UTSW 6 90,332,326 (GRCm39) missense probably damaging 0.99
R5698:Uroc1 UTSW 6 90,324,302 (GRCm39) missense probably damaging 1.00
R5789:Uroc1 UTSW 6 90,321,179 (GRCm39) missense probably damaging 1.00
R5853:Uroc1 UTSW 6 90,323,738 (GRCm39) missense probably damaging 0.99
R6063:Uroc1 UTSW 6 90,324,910 (GRCm39) missense probably benign 0.37
R6883:Uroc1 UTSW 6 90,315,574 (GRCm39) nonsense probably null
R7374:Uroc1 UTSW 6 90,315,815 (GRCm39) missense probably damaging 1.00
R7394:Uroc1 UTSW 6 90,322,315 (GRCm39) missense probably damaging 1.00
R7427:Uroc1 UTSW 6 90,323,344 (GRCm39) missense possibly damaging 0.56
R8224:Uroc1 UTSW 6 90,321,049 (GRCm39) splice site probably null
R8376:Uroc1 UTSW 6 90,314,697 (GRCm39) missense probably damaging 0.99
R8807:Uroc1 UTSW 6 90,328,110 (GRCm39) missense probably damaging 1.00
R8857:Uroc1 UTSW 6 90,334,510 (GRCm39) missense possibly damaging 0.74
R9418:Uroc1 UTSW 6 90,313,880 (GRCm39) missense probably benign 0.00
R9440:Uroc1 UTSW 6 90,322,353 (GRCm39) missense possibly damaging 0.94
X0021:Uroc1 UTSW 6 90,321,132 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TGTTCTGCTGGTCACATGGC -3'
(R):5'- ATACTGCAGGGTGAGACCAG -3'

Sequencing Primer
(F):5'- CACATGGCTTTATGAGGTAGAGGTC -3'
(R):5'- GGTGGTTCACAACAGTATCTCCAG -3'
Posted On 2015-04-06