Incidental Mutation 'R3874:Zfp568'
ID 276720
Institutional Source Beutler Lab
Gene Symbol Zfp568
Ensembl Gene ENSMUSG00000074221
Gene Name zinc finger protein 568
Synonyms chato, LOC381866
MMRRC Submission 040792-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R3874 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 29983955-30028282 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30023396 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 589 (C589S)
Ref Sequence ENSEMBL: ENSMUSP00000118387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074322] [ENSMUST00000146074] [ENSMUST00000148442] [ENSMUST00000177931]
AlphaFold E9PYI1
Predicted Effect probably damaging
Transcript: ENSMUST00000074322
AA Change: C589S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073930
Gene: ENSMUSG00000074221
AA Change: C589S

DomainStartEndE-ValueType
KRAB 34 94 2.73e-39 SMART
KRAB 124 184 2.01e-28 SMART
ZnF_C2H2 363 385 7.78e-3 SMART
ZnF_C2H2 391 413 3.95e-4 SMART
ZnF_C2H2 419 441 3.44e-4 SMART
ZnF_C2H2 447 469 2.2e-2 SMART
ZnF_C2H2 475 497 6.67e-2 SMART
ZnF_C2H2 503 525 6.32e-3 SMART
ZnF_C2H2 531 553 4.87e-4 SMART
ZnF_C2H2 559 581 2.09e-3 SMART
ZnF_C2H2 587 609 2.95e-3 SMART
ZnF_C2H2 615 637 3.69e-4 SMART
ZnF_C2H2 643 665 1.12e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000146074
AA Change: C588S

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118823
Gene: ENSMUSG00000074221
AA Change: C588S

DomainStartEndE-ValueType
KRAB 34 94 2.73e-39 SMART
KRAB 123 183 2.01e-28 SMART
ZnF_C2H2 362 384 7.78e-3 SMART
ZnF_C2H2 390 412 3.95e-4 SMART
ZnF_C2H2 418 440 3.44e-4 SMART
ZnF_C2H2 446 468 2.2e-2 SMART
ZnF_C2H2 474 496 6.67e-2 SMART
ZnF_C2H2 502 524 6.32e-3 SMART
ZnF_C2H2 530 552 4.87e-4 SMART
ZnF_C2H2 558 580 2.09e-3 SMART
ZnF_C2H2 586 608 2.95e-3 SMART
ZnF_C2H2 614 636 3.69e-4 SMART
ZnF_C2H2 642 664 1.12e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148442
AA Change: C589S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118387
Gene: ENSMUSG00000074221
AA Change: C589S

DomainStartEndE-ValueType
KRAB 34 94 2.73e-39 SMART
KRAB 124 184 2.01e-28 SMART
ZnF_C2H2 363 385 7.78e-3 SMART
ZnF_C2H2 391 413 3.95e-4 SMART
ZnF_C2H2 419 441 3.44e-4 SMART
ZnF_C2H2 447 469 2.2e-2 SMART
ZnF_C2H2 475 497 6.67e-2 SMART
ZnF_C2H2 503 525 6.32e-3 SMART
ZnF_C2H2 531 553 4.87e-4 SMART
ZnF_C2H2 559 581 2.09e-3 SMART
ZnF_C2H2 587 609 2.95e-3 SMART
ZnF_C2H2 615 637 3.69e-4 SMART
ZnF_C2H2 643 665 1.12e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177931
AA Change: C588S

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137438
Gene: ENSMUSG00000074221
AA Change: C588S

DomainStartEndE-ValueType
KRAB 34 94 2.73e-39 SMART
KRAB 123 183 2.01e-28 SMART
ZnF_C2H2 362 384 7.78e-3 SMART
ZnF_C2H2 390 412 3.95e-4 SMART
ZnF_C2H2 418 440 3.44e-4 SMART
ZnF_C2H2 446 468 2.2e-2 SMART
ZnF_C2H2 474 496 6.67e-2 SMART
ZnF_C2H2 502 524 6.32e-3 SMART
ZnF_C2H2 530 552 4.87e-4 SMART
ZnF_C2H2 558 580 2.09e-3 SMART
ZnF_C2H2 586 608 2.95e-3 SMART
ZnF_C2H2 614 636 3.69e-4 SMART
ZnF_C2H2 642 664 1.12e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants are embryonic lethal with growth arrest around E8.5-9.0. Mutant embryo shows shortened anterior-posterior axial extension with defects in somites and midline structures including open gut tube, cardia bifida, and failure to closeneural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130213A22Rik C A 11: 69,121,475 G26* probably null Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Acox2 A G 14: 8,248,061 I407T probably benign Het
Adam8 T C 7: 139,987,607 N408D probably damaging Het
Adgre1 A T 17: 57,401,925 T39S probably benign Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Arid1b T A 17: 5,336,515 probably null Het
Atp2c2 A G 8: 119,735,296 I303V possibly damaging Het
Bpifc C T 10: 85,991,254 V144I probably benign Het
C530008M17Rik A G 5: 76,840,892 D30G probably damaging Het
Camk4 A G 18: 33,158,854 E189G possibly damaging Het
Casz1 A G 4: 148,939,589 probably benign Het
Ccdc134 T C 15: 82,131,442 V41A possibly damaging Het
Chrd A T 16: 20,738,910 T753S probably damaging Het
Cyb561a3 T C 19: 10,585,371 V125A probably benign Het
D630039A03Rik T A 4: 57,910,606 T69S probably benign Het
Dchs1 A G 7: 105,761,635 F1687S probably damaging Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dnaic2 G T 11: 114,732,955 G15W probably damaging Het
Dsg1c A G 18: 20,277,052 I526V probably benign Het
Far2 G A 6: 148,150,591 E123K probably benign Het
Gli1 A T 10: 127,330,219 V1055E probably damaging Het
Hand2 G T 8: 57,321,976 A24S probably benign Het
Helb T C 10: 120,106,037 I249V probably benign Het
Hspa4l G A 3: 40,772,642 V492M probably damaging Het
Hspg2 T C 4: 137,539,349 I1916T probably damaging Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Kcnu1 T A 8: 25,885,317 L353H probably damaging Het
Klhl1 A G 14: 96,518,179 F47L probably benign Het
Klhl13 T C X: 23,285,176 D21G probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Krt9 C T 11: 100,190,849 V285I probably damaging Het
Mansc1 T C 6: 134,610,183 R344G possibly damaging Het
Mier2 G T 10: 79,541,797 P439T possibly damaging Het
Mppe1 T A 18: 67,225,886 probably null Het
Nedd4l G A 18: 65,167,535 A243T probably benign Het
Notch4 T A 17: 34,578,069 C934* probably null Het
Nsmce3 C T 7: 64,872,168 D251N probably damaging Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Olfr139 A G 11: 74,044,699 C192R probably damaging Het
Olfr517 C T 7: 108,869,128 V9M probably damaging Het
Olfr937 A G 9: 39,060,174 I164T probably benign Het
Pdzd7 T C 19: 45,045,628 T6A probably benign Het
Picalm T A 7: 90,189,219 F493Y probably damaging Het
Prl7d1 A G 13: 27,716,668 M1T probably null Het
Prl8a1 T C 13: 27,575,458 K199E possibly damaging Het
Rims1 C T 1: 22,428,489 R764H probably damaging Het
Rnf17 G T 14: 56,475,413 R779L possibly damaging Het
Rufy2 T C 10: 62,998,137 L294P probably damaging Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Slc22a30 G T 19: 8,336,849 T491K probably benign Het
Slc35b3 T C 13: 38,943,068 N20D possibly damaging Het
Slc5a4a T C 10: 76,181,655 F429L probably benign Het
Sulf1 T C 1: 12,817,412 I270T probably damaging Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Tnc T A 4: 64,008,710 I860F probably damaging Het
Trh A T 6: 92,243,698 V61E possibly damaging Het
Ttn T G 2: 76,754,099 T22222P probably damaging Het
Uroc1 A T 6: 90,361,512 K652* probably null Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r120 A T 17: 57,524,954 F278L probably benign Het
Vmn2r7 A G 3: 64,719,611 F86L possibly damaging Het
Vmn2r87 A T 10: 130,479,987 I70K possibly damaging Het
Vps13a C T 19: 16,744,953 A332T probably benign Het
Other mutations in Zfp568
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Zfp568 APN 7 30022440 missense possibly damaging 0.66
IGL00792:Zfp568 APN 7 30015072 missense probably benign 0.00
IGL01133:Zfp568 APN 7 29987808 critical splice donor site probably null
IGL01330:Zfp568 APN 7 30022277 missense probably benign 0.01
IGL03157:Zfp568 APN 7 30022764 missense probably damaging 1.00
R0739:Zfp568 UTSW 7 30023321 missense probably damaging 1.00
R1051:Zfp568 UTSW 7 30022529 nonsense probably null
R1967:Zfp568 UTSW 7 29989088 missense probably damaging 0.99
R2038:Zfp568 UTSW 7 29989082 missense probably null 1.00
R4438:Zfp568 UTSW 7 30022296 missense probably benign
R4584:Zfp568 UTSW 7 29998192 missense probably benign 0.04
R4667:Zfp568 UTSW 7 30023277 missense probably damaging 1.00
R4669:Zfp568 UTSW 7 30023277 missense probably damaging 1.00
R4773:Zfp568 UTSW 7 29997770 missense probably damaging 1.00
R4791:Zfp568 UTSW 7 30015183 missense probably damaging 1.00
R5250:Zfp568 UTSW 7 30017230 missense probably benign 0.12
R5541:Zfp568 UTSW 7 30022876 missense possibly damaging 0.81
R5956:Zfp568 UTSW 7 29997863 missense probably damaging 1.00
R6444:Zfp568 UTSW 7 30017257 missense probably benign 0.01
R6600:Zfp568 UTSW 7 30022523 missense possibly damaging 0.71
R7299:Zfp568 UTSW 7 30017244 missense probably benign 0.34
R7316:Zfp568 UTSW 7 30022256 missense possibly damaging 0.95
R7562:Zfp568 UTSW 7 30023256 missense probably benign 0.04
R7664:Zfp568 UTSW 7 30022290 missense probably benign
R7672:Zfp568 UTSW 7 29997787 missense probably damaging 0.99
R7759:Zfp568 UTSW 7 30023414 missense possibly damaging 0.66
R7790:Zfp568 UTSW 7 30022725 missense probably damaging 1.00
R7811:Zfp568 UTSW 7 29997870 missense possibly damaging 0.95
R8110:Zfp568 UTSW 7 30023126 missense probably damaging 1.00
R8194:Zfp568 UTSW 7 30023333 missense probably damaging 1.00
R8254:Zfp568 UTSW 7 30015133 missense probably benign 0.22
R8319:Zfp568 UTSW 7 29998204 missense possibly damaging 0.72
R8836:Zfp568 UTSW 7 30023034 missense probably damaging 0.98
R8902:Zfp568 UTSW 7 30013882 missense probably benign 0.08
R8978:Zfp568 UTSW 7 30017258 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGGTGTATAGCTGTGCCTCC -3'
(R):5'- GCACTTATAGGGCTTCTCACC -3'

Sequencing Primer
(F):5'- GGGAAAGGCTTCATCTCTGACTC -3'
(R):5'- ATAGGGCTTCTCACCGGTGTG -3'
Posted On 2015-04-06